Congenital Dyserythropoietic Anemia

"congenital dyserythropoietic anemia type ii: molecular analysis and expression of the sec23b gene.", by Punzo F, Bertoli-Avella AM, Scianguetta S, Della Ragione F, Casale M, Ronzoni L, Cappellini MD, Forni G, Oostra BA, Perrotta S. F2: Characterization of SEC23B mutations in patient A4. Lymphocytic cDNA was amplified using primers localized in exons 1 and 4 (A4-SEC23B-1F: TTGTACCCCTGGCTTGTCTC and A4-SEC23B-4R: ATGAACCTGCACCATCCTTC). The control shows the 425-bp product (wild-type, W.T.); (1) Patient...

Congenital dyserythropoietic anemia is an inherited blood disorder that influences the growth of red blood cells. This disorder is one of many types of anemia, which is a problem identified by a scarcity of red cell. Scientists have identified three major types of CDA: type I, type II, and type III. CDA type I is identified by modest to serious anemia. Many affected people have yellowing of the skin and eyes and an enlarged liver and spleen. Particularly, iron overload can lead to an abnormal heart rhythm, heart disease, diabetes, and chronic liver disease. Seldom, people with CDA type I are birthed with skeletal irregularities, frequently involving the toes and/or fingers. The anemia related to CDA type II can range from mild to severe, and most affected individuals have jaundice, hepatosplenomegaly, and the development of difficult deposits in the gallbladder called gallstones. This type of the disorder is usually diagnosed in adolescence or early their adult years. The signs and symptoms of CDA type III often tend to be milder than those of the other types. Most affected people do not have hepatosplenomegaly, and iron does not develop up in cells and organs. In their adult years, irregularities of a specialized tissue at the back of the eye can cause vision impairment. Some people with CDA type III additionally have a blood disorder called monoclonal gammopathy, which can lead to a cancer of white blood cells. Once scientists uncover the genetic causes of these versions, some of them may be organized with the three significant types of CDA.

* Please keep in mind that all text is summarized by machine, we do not bear any responsibility, and you should always check original source before taking any actions

** If you believe that content on the Plex is summarised improperly, please, contact us, and we will get rid of it quickly; please, send an email with a brief explanation.