Advanced searches left 3/3
Search only database of 8 mil and more summaries

Exonuclease

Summarized by PlexPage
Last Updated: 02 July 2021

* If you want to update the article please login/register

General | Latest Info

Oxidative damage to DNA caused by reactive oxygen species is believed to be a major type of endogenous cellular damage. If unrepaired, damage will tend to accumulate and lead to premature aging, neurodegenerative disorders, and cancer. More than 80 different oxidative modifications of DNA bases and sugar backbone have been identified to date. Diastereoisomeric - and - 8 5 - cyclo - 2deoxyadenosine and 8 5 - cyclo - 2deoxyguanosine are generated by endogenous oxidative stress and ionizing radiation among other oxidized bases. 8 5 - cyclo - 2deoxypurines are generated by hydroxyl radical attacking AT C5 sugar by H - abstraction resulting in formation of C5 - center sugar radical, which then reacts in the absence of oxygen with C8 of purine. Subsequent oxidation of the resulting N7 - centered radical leads to intramolecular cyclization with formation of covalent bond between C5 - and C8 - positions of purine nucleoside. When present in the DNA duplex, cdA causes large changes in backbone torsion angles, which lead to weakening of base pair hydrogen bonds and strong perturbations of helix conformation near lesion for both diastereoisomers. Interestingly, glycosidic bond in S - cdA is approximately 40 - fold more resistant to acid hydrolysis compared with regular dA, implying that this base lesion would be resistant to DNA glycosylase action. Cda adducts in DNA are strong blocks to various DNA polymerases, such as T7, and. Interestingly, translesion DNA Polymerase can perform lesion bypass synthesis on R - cdA but not on S - cdA. Both diastereomers of cdA also inhibit DNA transcription by blocking primer extension by T7 DNA Polymerase, and S - cdA inhibits binding of TATA box protein in vitro and strongly reduces gene expression in vivo. In addition, in vivo human RNA Polymerase II generates mutated RNA transcripts when using DNA template containing S - cdA. Give strong genotoxic effect of cdA adducts on DNA metabolism, cells should have a repair mechanism to remove these helix - distorting DNA adducts. Indeed, it has shown that nucleotide excision repair pathway can remove cdA adducts with an efficiency comparable to that of T = T cyclobutane dimers and exhibit higher activity in excising R - isomer. In agreement with biochemical data, it was shown that cdPu adducts accumulate in keratinocytes from xeroderma pigmentosum group C and Cockayne syndrome group patients exposed to X - rays and potassium bromate and also in organs of CS group B knockout mice. Importantly, cdA and cdG lesions accumulate spontaneously in the nuclear DNA of WT mice with age, suggesting that DNA repair is unable to keep a steady - state level of these complex DNA lesions over the lifespan of organism. Interestingly, S - cdA diastereoisomers are removed in NER pathway much less efficiently than corresponding 5 R - cdA ones and are also present AT higher level in nontreated mice organs. At present, NER is the only known DNA repair pathway to remove cyclopurine adducts in duplex DNA.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Significance to polymerase

Positions of M644, K967 and R988 in the structure of POL. Overview of structure of POL PDB 4M8O. Encircle regions are enlarged in panels B and C. K967 forms hydrogen bond based on primer strand at position N 2. R988 is able to form hydrogen bonds with both template and primer strands at positions N 4 and N 5. M644 is position under 3 - primer end and incoming nucleotide. Polymerase site to exonuclease site switch. Preform enzyme - DNA complexes were rapidly mixed with Heparin, magnesium acetate and 1 MM dATP, dCTP and dTTP. No dGTP was add, and this forced polymerase to incorporate mismatches. Reactions allowing multiple binding events in the absence of Heparin are indicated in the figure. Reactions were incubated for 2. 5 min at 30C and resolve on 10% denaturing polyacrylamide Gel. M - 1 indicates nucleotide prior to mismatch, M indicates mismatch, and M + 1 indicates extension of mismatch by one nucleotide. Band intensities of products were quantify, and percent mismatch was calculated by dividing mismatch by total extension products Table. Exonuclease site to polymerase site switch. Primer extension assays were performed by mixing preform enzyme - DNA complexes with magnesium acetate, physiological concentrations of dNTPs and Heparin. Reactions allowing multiple binding events in the absence of Heparin are indicated in the figure. Reactions were incubated for 2. 5 min at 30C and resolve on 10% denaturing acrylamide Gel. Band intensities of products were quantified and the percentage of corrected mismatches was calculated by dividing extension products by sum of excision and extension products Table. Polymerase site to exonuclease site switch in mutants. Preform enzyme - DNA complexes were rapidly mixed with Heparin, magnesium acetate and 1 MM dATP, dCTP and dTTP. No dGTP was add, and this forced polymerase to incorporate mismatches. Reactions allowing multiple binding events in the absence of Heparin are indicated in the figure. Reaction products were resolved on 10% denaturing acrylamide Gel. The M - 1 sign indicates nucleotide prior to mismatch, M indicates mismatch and M + 1 indicates extension of mismatch by one nucleotide. Band intensities were quantify, and percent mismatch was calculated by dividing mismatch by total extension products Table. Exonuclease site to polymerase site switch in mutants. Primer extension assays were performed by mixing preform enzyme - DNA complexes with magnesium acetate, physiological concentrations of dNTPs and Heparin. Reactions allowing multiple binding events in the absence of Heparin are indicated in the figure. Reactions were incubated for 2. 5 min at 30C and resolve on 10% denaturing acrylamide Gel. Band intensities of products were quantified and the percentage of corrected mismatches was calculated by dividing extension products by sum of excision and extension products Table. Nucleotide concentration effect on balance between exonuclease and polymerase activities under steady - state conditions. Preform enzyme - DNA complexes were mixed with magnesium acetate and physiologically balanced dNTPs.


INTRODUCTION

Fidelity of DNA replication depends on the accuracy with which DNA polymerase incorporates nucleotide, enzyme's built - in exonuclease activity that removes misincorporated nucleotides, and mismatch repair system that corrects errors that elude DNA polymerase. In eukaryotes, DNA polymerase is considered to be responsible for leading strand synthesis and DNA polymerase for lagging strand synthesis. Both enzymes have proofreading capacity with built in 3 - 5 exonuclease activity, and exonuclease and polymerase sites are located approximately 40 apart. Transfer of 3 - terminus of primer strand between polymerase and exonuclease sites occurs either through intermolecular mechanism that involves dissociation and reassociation events or through intramolecular mechanism without dissociating from template DNA. In general, DNA polymerases are non - exclusive between these options. The ability of replicative DNA polymerases to both synthesize and degrade DNA allows polymerases to build DNA with very high fidelity. However, partitioning between polymerase and exonuclease does not only influence fidelity, it also determines whether the net result is synthesis of a new DNA strand. The concept of balance was used as a metaphor by Reha - Krantz to describe the relationship between two activities. Under normal circumstances, polymerase activity dominates over exonuclease activity. However, there are substitutions in DNA polymerases that affect this balance by creating mutator polymerases or antimutator polymerases. Structural studies have revealed that large changes occur in positioning of thumb domain so as to accommodate transfer of DNA primer terminus between polymerase and exonuclease active sites. Separation of primer strand from template DNA is an energetically unfavorable process that requires assistance to occur. The mechanism by which the 3 - terminus of the growing DNA strand is transferred between the polymerase site and the exonuclease site is still unclear. Crystal structures have show that at least three to four base - pairs are separate, and this allows single - strand DNA to interact with grooves within the exonuclease domain that lead to exonuclease active site. Genetic studies of bacteriophage T4 reveal that mutations leading to substitutions in extended - hairpin loop influence fidelity of T4 DNA polymerase. Biochemical studies later showed that extend - hairpin loop influences switch between exonuclease site and polymerase site in B - family DNA polymerase from bacteriophage RB69. Pol consists of four subunits, Pol2, dpb2, dpb3 and Dpb4. Recently solved crystal structure of catalytic domain of Pol2. Conserve Leu / Met has been shown to be critical for selection of correct dNTP during replication. Substitutions at this residue have proven to be valuable for understanding the biological functions of POL and POL. Two such variants of POL M644G and M644Lhave been used to study ribonucleotide incorporation by POL, and both enzymes have distinct phenotypes. Compared to wild - type POL, M644G causes an increased mutation rate whereas M644L has a lower mutation rate.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

E. coli types

Ivec activity in various strains. To identify the principal mechanism underlying in vivo cloning in E. Coli, here referred to as iVEC, we first confirm iVEC activity in various conventionally used strains of E. Coli. We performed simple assay of iVEC activity by transforming strains with two DNA fragments that carry 20 bp of homologous overlaps at their ends: cat gene encoding chloramphenicol acetyltransferase and vector plasmid pUC19. As a result, transformants resistant to both ampicillin and chloramphenicol appear in all of the strains test, although the efficiency of transformation varies depending on host cells. Strains MG1655 and JC8679, in particular, had fewer transformants than other strains. To confirm that cat gene was clone into pUC19, purified plasmids derived from transformants were analyze. All of the purified plasmids were larger than empty vector,s pUC19. When plasmids were digested with BamHI, single band was detected in each lane, and the length of band matched that of cloned plasmid. Insertion of DNA into vector was also confirmed by PCR. Due to the smaller number of positive colonies in strains MG1655 and JC8679, we noticed that these strains have wild - type HsdR gene. Three other strains, DH5, AG1, and BW25113, have mutations in HsdR. Hsdr is a host specificity restriction enzyme, which degrades DNA containing unmethylated Hsd recognition sequence, and pUC19 DNA contains recognition sequence. Therefore, we introduce deletion mutation of HsdR gene into MG1655 and JC8679, resulting in strains SN1054 and SN1071, respectively. As a result, numbers of ampicillin - and chloramphenicol - resistant colonies after introduction of both cat fragment and linearize pUC19 were significantly increased by deletion of HsdR. Thus, various E. Coli strains essentially have the capacity to recombine short homologous sequences at ends of linear DNAs, permitting in vivo cloning of DNA fragments into linearized vectors. Reca and RecET are dispensable for iVEC activity. To elucidate the mechanism of iVEC activity in MG1655, we tested whether recombination proteins such as RecA or RecET were required for in vivo cloning ability. For this purpose, we introduce deletion mutations of RecA or RecET genes into strain SN1054. We then examine iVEC activity by transforming these deletion mutants with cat fragment and linearized pUC19. As a result, we found that deletion of RecA or RecET had little effect on iVEC activity, indicating that RecA and RecET are dispensable for in vivo cloning. Xtha is required for iVEC activity. In general, DNA recombination in E. Coli accompanies conversion of double - strand DNA to single - strand DNA by exonuclease. It is reported that E. Coli has at least seven exonucleases that prefer double - strand DNA for their substrates: XthA, RecE, ExoX, RecBCD, SbcCD, Nfo, and TatD. In addition, YgdG is an exonuclease whose preferential substrate is unknown. Therefore, we will next examine iVEC activity in exonuclease deletion mutants.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Discoveries in humans

Expression and purification of recombinant human Pol. Schematic structures of expression plasmids for Pol. Purification profile of Pol. Each fraction was electrophoresed in SDS 4 - 12% polyacrylamide gel and stained with Coomassie Brilliant Blue. Lane 1, load to Ni 2 + - Sepharose column; lane 2, flow - through of Ni 2 + - Sepharose column; lane 3, wash fraction with 1 M NaCl - containing buffer; lane 4, wash fraction with 100 mM imidazole - containing buffer; lane 5, eluate from Ni 2 + - Sepharose column with 300 mM imidazole - containing buffer; lane 6, flow - through of SP - Sepharose column, lane 7, wash fraction with 200 mM NaCl - containing buffer; lane 8, wash fraction with 500 mM NaCl - containing buffer; lane 9, eluate from SP column with 1 M NaCl - containing buffer. Purify Pol wild - type and exonuclease mutant enzymes. Purify recombinant human RFC visualize with Coomassie staining. Complementation of Xenopus egg extracts with recommended Pol. Single - strand circular DNA was annealed with non - radioactive ssDNA primer and used for replication synthesis in the presence of 32 P - dATP. Dna replication in Pol - or mock - deplete NPE. Samples taken at indicated times were treated with SDS / EDTA / Proteinase K and separated by 1% TAE / agarose gel electrophoresis. Rescue of replication defect by recombinant Pol.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Discoveries in yeast

Ccr4 - not is a general transcription regulatory complex in budding yeast that is found to be associated with mRNA metabolism, transcription initiation, and mRNA degradation. Ccr4 has been found to contain RNA and single - strand DNA 3 to 5 exonuclease activities. Another component associated with CCR4 - not is CAF1 protein, which has been found to contain 3 to 5 or 5 to 3 exonuclease domains in mouse and Caenorhabditis elegans. This protein has not been found in yeast, which suggests that it is likely to have abnormal exonuclease domain like one seen in metazoan.S Yeast contains Rat1 and XRN1 exonuclease. Rat1 works just like the human type and XRN1 function in cytoplasm is in 5 to 3 directions to degrade RNAs in the absence of Rat1.


Introduction

Nucleases cleave phosphodiester bonds of nucleic acids and play essential roles in many aspects of cellular metabolism and in defense against viral invasions 1 2. While endonucleases cut nucleic acids internally, yielding poly or oligonucleotides, exonucleases catalyze excision of nucleotide monophosphates from 3 - or 5 - DNA termini. Exonucleases can be classified into several classes according to their functional and conformational states: autonomous exonucleases, polymerases - associate exonucleases, and helicases - associate exonuclases 1. One of the main examples of helicase - associated exonuclease is the RecBCD enzyme: heterotrimeric helicase / nuclease that initiates homologous recombination at double - strand DNA breaks 3. The enzyme is driven by two motor subunits, RecB and RecD, translocating on opposite single - strands of DNA duplex 4 5. During unwinding, nuclease in RecB domain nicks 3 - strand or cleaves both DNA strands endonucleolytically depending on Mg 2 + concentration 6. Another example is protein involved in Werner syndrome, genomic instability disorder characterized by premature aging symptoms 7. Wrn gene defective in WS encodes protein of RecQ helicase family possessing both 3 - 5 helicase at C - terminus and 3 - 5 exonuclease activities at amino terminus in same polypeptide 8 9. While WRN helicase and exonuclease domains are shown to act independently on D loops and Holliday junctions, two domains could act in coordinated fashion in vitro on forked duplex 10, or to resolve recombination intermediate 10 11. The Pif1 family of helicases is highly conserved from bacteria to human 12. Interest in Pif1 helicases has been considerably increased since discovery that this family of helicases plays multiple functional roles in maintenance of genomic integrity: it disrupts telomerase from telomere ends and advances fork progression at many nuclear sites; facilitates replication and suppresses DNA damage at G - quadruplex motifs; processes Okazaki fragments maturation in cooperation with Dna2 helicase / nuclease and promote break - induced replication via bubble migration 13 14 15 16 17 18. In this study, we report previously undiscovered helicase - associated exonuclease activity from CaPif1. Importantly, different from above mention helicase - associate exonucleases in which helicase and exonuclease domains possess structurally autonomous domains or motifs, and each helicase and exonuclease domain being active in isolation, residues implicated in exonuclease active sites of CaPif1 appear to be embed in Pif1 helicase domains, indicating that helicase and exonuclease activities are not structurally separable. More interestingly, it appears that this property is well conserve, at least, among fungal species.


Results and discussion

Various mechanisms have been proposed for eccDNA formation involving repair of single strand breaks or DSBs that are either linked to DNA replication or not. To delimit the eccDNA formation mechanism, we analyse eccDNA accumulation in the selection of DSB processing mutants. Many DSB processing mutants have shortened lifespans and cannot age sufficiently to show eccDNA accumulation; However, we characterise small panel of informative DSB repair mutants that age effectively in the MEP system. Firstly, loss of Dnl4, critical DNA ligase for nonhomologous end joining, does not substantially alter CUP1 eccDNA or ERC levels. Secondly, loss of exonuclease Exo1, which is involved in long - range DNA end resection as well as degradation of stall or reverse replication forks, had no effect on CUP1 eccDNA but substantially increased ERC levels. Thirdly, absence of end - resection factor Sae2 caused major reduction in CUP1 eccDNA but had little effect on ERCs. Sae2 is important for initiating DNA end resection from DSBs, particularly when DNA ends are blocked or cannot be process, and the importance of this factor for CUP1 eccDNA formation suggests a formation mechanism involving DNA damage. In contrast, ERCs are known to form through replication fork stalling mechanism that is consistent with increased ERC levels in Exo1 cells in which stall fork degradation is impair. Therefore, observation that CUP1 eccDNA but not ERC accumulation is dependent on Sae2 strongly suggests that these species do not form by same mechanism in aged cells. Usefully, normal accumulation of ERCs in Sae2 demonstrates that reduced CUP1 eccDNA cannot simply be attributed to ageing defect, because this would also diminish ERC levels. To ensure that this critical phenotype was reproducible, we generated 2 further Sae2 mutants in MEP background with different markers and consistently observed the same phenotype. Sae2 mediates end resection, stimulating nuclease activity of Mre11 to generate short single - strand 3 end and allow access to long - range resection activities of Exo1 and Dna2 / Sgs1. Mre11 is a member of the Mre11 - Rad50 - Xrs2 complex, and life span is severely compromised in Mre11 cells just as for previously described Rad50 mutants. However, MRX has important functions in DSB repair beyond resection, and we observe that cells carrying nuclease deficient Mre11 H125N allele behave similarly to wild types during ageing. Importantly, Mre11 H125N cells are defective in CUP1 eccDNA accumulation but have little defect in ERC accumulation, mirroring the Sae2 phenotype. Sgs1 and particularly Sgs1 Exo1 mutants show variable but severe life span defects and therefore the importance of long - range resection could not be assess. Nonetheless, these results show that DSB formation and resection are critical steps in CUP1 eccDNA formation. To reveal locus specificity of Sae2 function in eccDNA formation, we perform REC - seq in Sae2 mutants and also in spt3 mutants to allow comparison between defects in eccDNA formation and retention. Global effects on eccDNA levels are not captured by our original REC - seq method because there is no way to normalise read counts between samples.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Acknowledgements

Dna flap structure used in characterisation of cleavage specificity of T5 53 exonuclease. The flap structure is composed of a flap strand, template strand and adjacent strand. Flap strand is 5 - 32 P - label in these studies. Arrows indicate sites of reaction. 5 - overhanging hairpin, HP1. Oligonucleotide is 5 - 32 P - label in kinetic studies. Arrow indicates site of reaction. Phosphor image of time course of T5 53 exonuclease catalyse hydrolysis of 5 - 32 P - label HP1. The following conditions were used for this experiment: 25 mM CHES, pH 9. 3 50 mM KCl, 10 mM MgCl 2 1 mM 32 P - labelled HP1 60 nM enzyme, 37C. Lane 1 is the control Lane with no enzymes present. Lanes 2 - 10, time points were taken at following time intervals 10 and 20 S and 1 2 5, 10 17 25 and 40 min. Plots of normalised initial rate of reaction against substrate concentrations for mutant enzymes. Each data point is the mean of at least three independent experiments. Error bars represent standard errors in these experiments. Full details of experimental conditions are given under Materials and Methods. K83a. Data has been fitted into the Michaelis - Menten equation with an R factor of 0. 98. K196a. Data has been fitted into the Michaelis - Menten equation with an R factor of 0. 90. K215a. Data has been fitted into the Michaelis - Menten equation with an R factor of 0.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Results

Predicted Chlamydomonas EXO Protein belongs to the DnaQ - H superfamily of 3 to 5 exonucleases, with DEDDh motif that is characteristic of the 3hExo / ERI - 1 subfamily. 3hexo exoribonuclease was initially identified as candidate regulator of histone mRNA degradation in mammalian cells, but its in vivo role is not clear since decay of histone transcripts involves similar pathways to those required for degradation of poly mRNAs after deadenylation. Intriguingly, closest C. Elegans and Schizosaccharomyces pombe homologs of 3hExo, named ERI - 1, have been implicated as negative regulators of RNAi and in 5. 8s rRNA processing. Another member of this subfamily, Drosophila melanogaster Snipper, efficiently degrades structured, dsRNA, and DNA substrates as long as there exist 3 overhang of few nucleotides to initiate decay. However, in vivo function of Snipper remains unknown since SNP mutant flies are viable and display no obvious phenotypic abnormalities. Human Snipper homolog, name exonuclease domain containing 1, is produced in two isoforms: shorter one similar in structure to Snipper and a longer one that include, in addition to exonuclease domain, zinc finger of GRF type. Thus, exonucleases belonging to the 3hExo / ERI - 1 subfamily appear to show activity toward diverse array of substrates and play a variety of roles. Transgenic lines transformed with MAA7 / EXO IR containing plasmids and resistant to 5 - FI also show reduced levels of EXO transcript in semiquantitative RT - PCR assays, consistent with RNAi - mediate suppression of both MAA7 and EXO genes. This observation applies to strains generated with MAA7 / EXO3 IR vector as well as those generated with MAA7 / EXO5 IR transgene. However, degree of EXO gene suppression varies among different transgenic lines. In contrast, MAA7 - IR5 strain, containing an IR transgene designed to downregulate exclusively MAA7, does not display any decrease in EXO mRNA levels when compared with the wild type. Thus, TIR - RNAi system, as previously demonstrated for several unrelated genes, allows recovery of effective EXO - suppress RNAi strains by selection for MAA7 silencing in medium containing 5 - FI. The Eri - 1 exonuclease has been implicated in degradation of siRNA duplexes with two - nucleotide 3 overhangs, reducing efficiency of RNAi, and in endogenous small RNA pathways in C. Elegans. Thus, we test whether Chlamydomonas EXO might act as RNAi regulator in transgenic lines. However, EXO - suppress RNAi strains do not show any change in levels of several endogenous small RNAs when compared with wild - type CC - 124. Mammalian homolog of ERI - 1 3hExo has been proposed to play a role, although presently undefined, in histone mRNA metabolism. Interestingly, when we examine Chlamydomonas lines containing MAA7 / EXO IR transgenes for histone H2A transcript amounts, they display significant reduction in comparison with control strains. Most core histone genes in Chlamydomonas, similarly to those in metazoans, have highly conserved palindromic sequence AT their 3 end, within short distance of stop codon.


Introduction

Bacteriophage 29 DNA polymerase belongs to the family B of DNA - dependent DNA polymerases 1 and is fully responsible for viral DNA replication 2. It is endowed with specific properties that make it different from the rest known replicases. First, 29 DNA polymerase initiates DNA replication by using Terminal Protein as primer 3, bypassing need for primase. It has intrinsic high processivity and strange displacement capacity, that allow it to replicate the entire genome from single binding event without requiring assistance of processivity or unwinding factors 4. Strand displacement activity in 29 DNA polymerase is more efficient than that of other replicative DNA polymerases like those of bacteriophages T4 or T7 5, allowing 29 polymerase to work as a hybrid polymerase helicase to couple efficiently DNA replication and unwinding activities within the same polypeptide 6. Both properties, processivity and strand displacement allow 29 DNA polymerase molecule,s after the transition stage during which sequential switch from TP - priming to DNA - priming occur, to replicate the entire viral genome from single binding event 4. Besides these features, 29 DNA polymerase has high fidelity due to high nucleotide insertion discrimination values and to 3 - 5 exonuclease activity that proofread polymerization errors 7 8. 29 DNA polymerase is the only member of the Protein - prim subgroup of DNA polymerases whose structure has been solve. It has N - Terminal domain with 3 - 5 exonuclease activity and C - Terminal domain with polymerization activity 9. The function of 3 - 5 exonuclease activity of DNA polymerases is to remove nucleotides that have been incorrectly incorporated prior to their extension 10, contributing around two orders of magnitude to its fidelity 11. Although polymerization and exonuclease activities are governed by catalytic sites placed in two structurally distant domains 9, both activities must act in concert to achieve productive and accurate replication. When an incorrect nucleotide is incorporate, 3 terminus of the primer must be physically moved from the polymerase to the exonuclease active site for removal of misinserted nucleotide, and then the correct primer returns to polymerization active site 12. Thus, formation of the exonuclease complex requires melting of primer - end and its transfer to exonuclease active site 13. Previous results show that 29 DNA polymerase edit polymerization errors using an intramolecular pathway, so the primer terminus moves from one active site to other without dissociation from DNA 14. Polymerase domain can be subdivided into universally conserved subdomains: palm, thumb and fingers by analogy to the semi - open right hand. Palm contains catalytic and DNA ligand residues, finger dNTP ligands and thumb bind DNA conferring stability to primer 9. There are also two insertions specifically present in the Protein - prim DNA polymerases subgroup called Terminal Protein Regions 1 and 2. Tpr1 subdomain is involved in interaction with TP 15.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Discussion

Wrn exonuclease activity on substrates containing 5OH - Ura and 5OH - Cyt in digested strand of substrate. Wrn exonuclease blockage on recessed substrates. Recess substrates containing undamaged or 5OH - Cyt and 5OH - Ura in digested strand were incubated in the absence or presence of WRN as indicated, for 1 h at 37C. Reaction products were separated on 14% polyacrylamide denaturing gel and visualized by phosphorimaging. Wrn exonuclease blockage on forked substrates. Unmodified or modified DNA substrates, containing lesions in digested strands of substrate were incubated with increasing amounts of WRN for 15 min at 37C. Reaction products were separate and visualized as described Positions of lesions are indicated by arrows. Und, undamaged; 8oxo - Ade, 8 - oxoadenine; 8oxo - Gua, 8 - oxoguanine; 5OH - Cyt, 5 - hydroxycytosine; 5OH - Ura, 5 - hydroxyuracil; 5OHMe - Ura, 5 - hydroxymethyluracil; 2OH - Ade, 2 - hydroxyadenine, Fapy - Gua, 2 6 - diamino - 4hydroxy - 5formamidopyrimidine; Fapy - Ade, 4 6 - diamino - 5formamidopyrimidine. Ku stimulation of WRN exonuclease on substrates containing 5OH - Ura and 5OH - Cyt in digested strand of substrate. Ku stimulation of WRN exonuclease past lesions position in recessed substrates. Undamaged recessed substrate leave panel or recess substrate containing 5OH - Cyt or 5OH - Ura in digested strand, were incubated with indicated amounts of WRN protein, in the absence or presence of Ku for 1 h at 37C. Ku stimulation of WRN exonuclease activity on forked substrates. Fork DNA substrates were incubated for 15 min at 37C with WRN, in the absence or presence of Ku. Reactions were terminated and reaction products were processed as described in Figure 1. Positions of lesions are indicated by arrows. Und, undamaged substrate; 5OH - Cyt, 5 - hydroxycytosine; 5OH - Ura, 5 - hydroxyuracil, 8oxo - Gua, 8 - oxoguanine. Ape1 exonuclease activity on substrates containing oxidative lesions in digested strand of substrate. Fork substrates were incubated with APE1 for 15 min at 37C. Fork substrates were incubated for 15 min at 37C with APE1 and Ku as indicated. Positions of lesions are indicated by arrows. Reactions were terminated and reaction products were processed as described in Figure 1. Und, undamaged; 8oxo - Ade, 8 - oxoadenine; 8oxo - Gua, 8 - oxoguanine; 5OH - Cyt, 5 - hydroxycytosine; 5OH - Ura, 5 - hydroxyuracil; 5OHMe - Ura, 5 - hydroxymethyluracil; 2OH - Ade, 2 - hydroxyadenine. Wrn exonuclease activity in presence of lesions positioned in non - digested strand of substrates. Fork substrates were incubated for 15 min at 37C with increasing amounts of WRN. Fork substrates were incubated for 15 min at 37C without or with WRN and with Ku as indicated. Reactions were terminated and reaction products were processed as described in Figure 1. Positions of lesions are indicated by arrows. Und, undamaged; 8oxo - Gua, 8 - oxoguanine; AP site, abasic site; 5OH - Ura, 5 - hydroxyuracil.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Materials and Methods

Dna replication errors are an important source of genetic change. Several biochemical activities have evolved in order to prevent errors from becoming mutations. One is 35 exonuclease activity present in many DNA polymerases. The well - established function for this exonuclease activity is proofreading of errors made by DNA polymerase. Mismatch repair is a second fidelity system that can correct replication errors which escape proofreading. Characteristically, mutations that inactivate exonuclease activity of replicative DNA polymerase combine with those which inactivate MMR confer very strong mutator phenotype, far exceeding the sum of individual mutator effects. Such synergistic hypermutability caused by combination of proofreading and MMR defects can also lead to accumulation of lethal mutations sufficient to block propagation of double - mutant strain. Another synergistic interaction between exonuclease deficiency in Pol and mutations in RAD27, which encode 5 - flap endonuclease FEN1, highlights the role of Pol - Exo in creating or maintaining ligatable nick during Okazaki fragment maturation. These two genetic defects are often synthetic lethal. In vivo evidence that Pol - Exo supplements FEN1 in Okazaki maturation was obtained with viable double mutants that that involve RAD27 - P allele with partial defect. These mutants exhibit hyperrecombination and an unusual pattern of hypermutability. The most frequent class of mutations were extended duplications flanked by short direct repeats. Such mutations are usually observed when removal of 5 - flaps generated by DNA polymerase displacement between Okazaki fragments is impaired. In agreement with the proposed defect in Okazaki maturation, biochemical experiments have demonstrated that strand displacement by Exo - deficient Pol is increased to such an extent that full activity of FEN1 was required in order to create ligatable nick. An additional mutation avoidance function of Pol - Exo that is distinct from proofreading has been suggested based upon strong mutator Synergy with mutations in EXO1. Exonuclease I was discovered in yeast as 53 double - strand DNA - exonuclease. However, its human homolog is capable of supporting both 5 and 3 excision during MMR in extracts and in reconstituted system.S Exo1 has been used in double - strand break repair and recombination, telomere maintenance, Okazaki fragment maturation, and in MMR. Exo1 physically interacts with eukaryotic MutS and MutL complexes and, based on genetic data, was also proposed to play a structural role in MMR. In yeast Saccharomyces cerevisiae, mutator defects caused by deletion of EXO1 or by mutations inactivating its exonuclease are much milder than those due to elimination of mismatch recognition. Weak mutator effects of EXO1 deficiency in yeast depend in part on Pol lesion bypass polymerase as determined from epistatic interactions with rev3. It was suggested that EXO1 participates in MMR - independent mutation avoidance pathway as well as in mismatch removal during MMR. By analogy with Escherichia coli, it was suggested that mismatch removal in eukaryotic MMR could be accomplished by several redundant nucleases, including EXO1.


DISCUSSION

All pol3 - L523X mutations show synthetic lethality and / or mutator synergy with msh2, Exo1, and rad27 mutations, highlighting in vivo defects in proofreading, MMR, and Okazaki fragment maturation, respectively. All mutants have wild - type DNA polymerase activity but exhibit exonuclease - related defects. Base on comparison of in vitro switching and exonuclease activity defects of pol3 - L523X mutants with their in vivo defects, we conclude that the function of nuclease in proofreading, MMR, and Okazaki fragment maturation require efficient switching. This conclusion is most straightforward for pol3 - L523H mutant. In vitro Pol - L523H shows wild - type exonuclease activity, while exhibiting partial switching defect. Therefore, in vivo defects in proofreading, MMR, and Okazaki fragment maturation, revealed as synergistic hypermutability in combination with msh2, Exo1, and rad27 - p, are likely to result from defect in switching. Similar arguments can be made for pol3 - L523S mutant. In vivo defects in pol3 - L523S msh2 and pol3 - L523S Exo1 double mutants are comparable with those of double mutants involving catalytically null pol3 - 5DV table. However, unlike Pol - 5DV, Pol - L523S mutant enzyme retains 70% of wild - type exonuclease activity, indicating that switching defect in this mutant contribute substantially to observed phenotypes. In summary, biological defects in pol3 - L523X mutants exceed level expected from just partial deficiency in exonuclease activity. We conclude that switching from polymerase to exonuclease domain in Pol is required for its multiple roles in vivo. As discussed below, this requirement leads us to propose that exonuclease mediates its functions primarily within the holoenzyme complex that is performing DNA synthesis.


3-5 Exonuclease Assays.

Exonuclease activities of purified recombinant Ecoli and human NDKs were tested with standard 30 - mer single - strand oligonucleotide, 5 - CTCGTCAGCATCATGATCATACAGTCAGTG - 3. To verify substrate specificity, various oligonucleotide substrates were test. Oligonucleotide sequences were 5 TTGAGGCAGAGTCC, 5 GGACTCTGCCTCAA, 5 GGACTCT - GCCTCAAG, 5 GGACTCTGCCTCAAGACG, 5 CACGTTGACTA - CCGTC, 5 GGACTCTGCCTCAAGACGGTAGTCAA - CGTG, and 5 GATGTCAAG - CAGTCCTAAGTTTGAGGCAGAGTCC. 5 end - labeling of each top strand was carried out with T4 polynucleotide kinase and 32 P - ATP. End - label oligonucleotides were annealed to their complementary bottom strands in the annealing buffer. The standard assay was performed at 30 l volume with reaction buffer, 5 pmoles DNA, and E. Coli or human NDKs at 37C for 1 hour. Exonuclease activity of human NDK1 mutants was tested with 5 end - label single - strand 30 - mer in standard assay as described above. For competition assays between wild type and catalytically inactive mutants, 0. 5 - 5 g of human NDK1 mutants E5A, E5Q, E129A, and E129Q, were preincubated with 5 end - label single - strand 30mer in reaction buffer at room temperature for 20 min. After adding 0. 5 g of wild type protein, additional reaction was carried out at 37C for 30 min. Reaction was terminated by phenol / chloroform extraction and ethanol precipitation. Dna pellet was dissolved in formamide loading dye. Cleavage of oligomers was analyzed by 16% denaturing polyacrylamide gel electrophoresis. To test processing of substrates containing modified bases, double strand oligonucleotides containing U / or Tg / pairs were used. 30 - mer top strand oligonucleotides were 5 - CTCGTCAGCATCA - GATCATACAGTCAGTG - 3, where U or Tg stands for uracil and thymine glycol, respectively. 5 - label top strands were annealed to bottom strands and double strand oligonucleotides containing uracil were first incubated with E. Coli UDG or human UDG for 20 min at 37C. After directly adding human APE1, mixtures were incubated for an additional 20 min at 37C. Reaction mixtures were split into two further reactions with hNDK1, direct incubation with hNDK1 or incubation with hNDK1 after removing UDG and hAPE1 by phenol / chloroform extraction and ethanol precipitation. Samples were incubated for an additional 30 min at 37C. Cleave DNA was analyzed as described above.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Endonuclease Definition

Comparison Chart

PropertiesEndonucleaseExonuclease
Mode of actionIt separates the nucleotides into two or more fragmentIt removes the nucleotides one by one from the fragment
Site of occurrenceCleavage occurs in the middle of the polynucleotide chainCleavage occurs at the end of the polynucleotide chain
3 or 5-OH groupsDo not requireIt requires
Lag-phaseUndergo lag period before their activityAbsent
SpecificitySequence specificNon-specific
ResultIt releases oligonucleotidesIt releases nucleosides
RolePlays an important role in DNA repair, blocks the entry of pathogenPlays an important role in DNA repair, stabilization and proofreading but does not blocks the entry of the pathogen

Endonucleases are enzymes that cleave phosphodiester bonds within the polynucleotide chain. Some of them have no regard to sequence when cutting DNA, but many others do so only at specific nucleotide sequences. The latter group is often called Restriction Endonucleases or Restriction enzymes. Endonucleases can be distinguished from exonucleases, which cut ends of recognition sequences and not the middle portion, unlike endonucleases. It is also possible for enzyme to display both functions, and these are know as Exo - Endonucleases. Comparing endonuclease activity to exonuclease activity, evidence suggests that former experiences lag compared to the latter. Endonuclease Mechanism Restriction enzymes are endonucleases from eubacteria and archaea that recognize specific DNA sequence. The restriction site is a nucleotide sequence that is recognized for cleavage by the restriction enzyme, and it is usually a palindromic sequence of four to six nucleotides. Cleaving is often performed unevenly, which leaves single - strand ends which can use hybridization to reconnect. Phosphodiester bonds of fragments can be joined through DNA ligase when they have been pair. Every restriction endonuclease that is known attacks different restriction site, which means there are hundreds of restriction sites for hundreds of Restriction Endonucleases. The origin of DNA has no impact on the ability of DNA fragments that have been cloven to join together. This is know as recombinant DNA, which is formed by joining of genes in new combinations. There are three categories of Restriction Endonucleases: Type I, Type II and Type III. They are categorized based on their mechanism of action. They are regularly used in genetic engineering to create recombinant DNA, which can be introduced into different cells of bacterial, plant or animal origin. They can also be used in synthetic biology. Cas9 is one notable example of endonuclease. It is a protein which plays an important role in immunological defense of certain bacteria against DNA viruses. It has become more well - known due to its uses in genetic engineering. Endonuclease Structure Type I and Type II Restriction Endonucleases are multisubunit complexes that include endonucleases and methylase activities. Type I Restriction enzymes are capable of cleaving random sites of approximately 1 000 base pairs from recognition sequence. Type II enzymes are simpler and don't require ATP as an energy source, unlike Type I. Type III cleaves DNA at approximately 25 base pairs from recognition sequence and, like Type I, requires ATP. Endonuclease Function Endonucleases contribute to DNA repair. Incision of DNA at AP sites is catalyzed by AP endonuclease, which ready DNA for excision, repair synthesis and DNA litigation. There are two AP Endonucleases in Ecoli cells, which eukaryotes have just one AP endonuclease. Mutations can also occur in endonucleases. A defect in UV - specific endonuclease causes rare autosomal recessive disease xeroderma pigmentosa, which means that DNA damage caused by sunlight can't be repair. Sickle Cell anemia is another result of mutation, when the recognition site for Restriction endonuclease that recognizes nucleotide sequences is eliminate.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

Table

Basis for ComparisonEndonucleaseExonuclease
DefinitionAn endonuclease is a group of enzymes that cleave the phosphodiester bond present within a polynucleotide chain.Exonucleases are enzymes that cleave DNA sequences in a polynucleotide chain from either the 5 or 3 end one at a time.
CleavageEndonucleases cleave the nucleotide sequence from the middle.Exonulceases cleave a nucleotide sequence from the ends.
Lag periodSome endonucleases like restriction endonucleases have a lag period before their activity.Exonuclease does not have a lag period before their activity.
Results inEndonucleases cleave DNA sequences, resulting in oligonucleotides.Exonulceases cleave DNA sequences, resulting in individual nucleotides or nucleosides.
EndsEndonucleases might form either sticky or blunt ends.Exonulceases form sticky ends.
SpecificitySpecific endonucleases, also called restriction endonucleases, are available that cleave specific sites within a DNA sequence.Exonuclease is usually non-specific.
Defensive propertiesEndonucleases have defensive properties against the entry of pathogenic microorganisms.Exonulceases do not have defensive properties.
Effect on circular DNARestriction endonuclease can cleave specific sites within a circular DNA.Exonulceases have less activity towards circular DNA as compared to linear DNA.
InhibitionEndonucleases cannot be inhibited phosphorothioate bonds unless the entire sequence has the bonds between all nucleotides.Exonuclease can be inhibited by adding five phosphorothioate bonds in a row to a sequence.
Free endsFree 3 or 5 ends are not necessary for the action of endonucleases.The ends should be free for the action of exonucleases.
ExamplesEcoRI, BamHI, Deoxyribonulcease I are some examples of endonucleases.Snake venom, Exonuclease I, Xrn1 are some examples of exonucleases.
* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Sources

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

logo

Plex.page is an Online Knowledge, where all the summaries are written by a machine. We aim to collect all the knowledge the World Wide Web has to offer.

Partners:
Nvidia inception logo

© All rights reserved
2021 made by Algoritmi Vision Inc.

If you believe that any of the summaries on our website lead to misinformation, don't hesitate to contact us. We will immediately review it and remove the summaries if necessary.

If your domain is listed as one of the sources on any summary, you can consider participating in the "Online Knowledge" program, if you want to proceed, please follow these instructions to apply.
However, if you still want us to remove all links leading to your domain from Plex.page and never use your website as a source, please follow these instructions.