Advanced searches left 3/3
Search only database of 8 mil and more summaries

Exonuclease Activity

Summarized by PlexPage
Last Updated: 02 July 2021

* If you want to update the article please login/register

General | Latest Info

Oxidative damage to DNA caused by reactive oxygen species is believed to be a major type of endogenous cellular damage. If unrepaired, damage will tend to accumulate and lead to premature aging, neurodegenerative disorders, and cancer. More than 80 different oxidative modifications of DNA bases and sugar backbone have been identified to date. Diastereoisomeric - and - 8 5 - cyclo - 2deoxyadenosine and 8 5 - cyclo - 2deoxyguanosine are generated by endogenous oxidative stress and ionizing radiation among other oxidized bases. 8 5 - cyclo - 2deoxypurines are generated by hydroxyl radical attacking AT C5 sugar by H - abstraction resulting in formation of C5 - center sugar radical, which then reacts in the absence of oxygen with C8 of purine. Subsequent oxidation of the resulting N7 - centered radical leads to intramolecular cyclization with formation of covalent bond between C5 - and C8 - positions of purine nucleoside. When present in the DNA duplex, cdA causes large changes in backbone torsion angles, which lead to weakening of base pair hydrogen bonds and strong perturbations of helix conformation near lesion for both diastereoisomers. Interestingly, glycosidic bond in S - cdA is approximately 40 - fold more resistant to acid hydrolysis compared with regular dA, implying that this base lesion would be resistant to DNA glycosylase action. Cda adducts in DNA are strong blocks to various DNA polymerases, such as T7, and. Interestingly, translesion DNA polymerase can perform lesion bypass synthesis on R - cdA but not on S - cdA. Both diastereomers of cdA also inhibit DNA transcription by blocking primer extension by T7 DNA polymerase, and S - cdA inhibits binding of TATA box protein in vitro and strongly reduces gene expression in vivo. In addition, in vivo human RNA polymerase II generates mutated RNA transcripts when using DNA template containing S - cdA. Give strong genotoxic effect of cdA adducts on DNA metabolism, cells should have a repair mechanism to remove these helix - distorting DNA adducts. Indeed, it has shown that nucleotide excision repair pathway can remove cdA adducts with an efficiency comparable to that of T = T cyclobutane dimers and exhibit higher activity in excising R - isomer. In agreement with biochemical data, it was shown that cdPu adducts accumulate in keratinocytes from xeroderma pigmentosum group C and Cockayne syndrome group patients exposed to X - rays and potassium bromate and also in organs of CS group B knockout mice. Importantly, cdA and cdG lesions accumulate spontaneously in the nuclear DNA of WT mice with age, suggesting that DNA repair is unable to keep a steady - state level of these complex DNA lesions over the lifespan of organism. Interestingly, S - cdA diastereoisomers are removed in NER pathway much less efficiently than corresponding 5 R - cdA ones and are also present AT higher level in nontreated mice organs. At present, NER is the only known DNA repair pathway to remove cyclopurine adducts in duplex DNA.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Significance

Oxidative DNA damage has been postulated to play an important role in human neurodegenerative disorders and cancer. 8 5 - cyclo - 2deoxyadenosine is generated in DNA by hydroxyl radical attack and strongly blocks DNA replication and transcription. Here we demonstrate that cdA adducts at 3 termini of DNA can be removed by 3 - 5 exonuclease activity of apurinic / apyrimidinic endonucleases: Escherichia coli Xth and human APE1. The crystal structure of bacterial AP endonuclease in complex with DNA duplex provides insight into the mechanism of this activity. This new repair function provides an alternative pathway to counteract the genotoxic effect of helix - distorting DNA lesions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Results

To characterize the specificity of APE1 interactions with S - cdA adducts, we measured kinetic parameters of excision of 3 - terminal S - cdA adduct by APE1 under steady - state conditions. Comparison of kinetic constants for recessed DNA substrates containing different DNA lesions on 3 termini show that K cat / K M value for WT APE1 - catalyzed excision of S - cdA adduct was two - and fivefold higher compared with that for 3 - terminal THF residue and regular 3 - terminal dA nucleotide, respectively. These results indicate that the efficiency of APE1 3 cleansing activity for S - cdA adduct was comparable to that for the 3 sugar - phosphate group and significantly higher than for regular deoxynucleotide in recessed DNA duplex. Next, to understand the mechanism of inhibition of APE1 35 exonuclease activity on recessed DNA duplex containing S - cdA adduct located 1 nt away from 3 end, we studied interactions between APE1 and 5 - label AT rec, cdAT rec, and cdAAT rec duplexes using EMSA. Ape1 binds to recessed duplex cdAT rec with 3 - terminal S - cdA more efficiently than to regular AT rec duplex and essentially fails to form stable DNA - protein complexes with cdAAT rec duplex in which S - cdA nucleotide is located AT second position from 3 end of gap. These results suggest that lack of APE1 activity on recessed DNA duplexes containing S - cdA adduct 1 or more nt away from 3 end might be due to loss of enzyme affinity to DNA substrate.


DISCUSSION

Proofreading decreases with the increased size of homonucleotide run that is replicate. Previously, it has been shown that both MMR and DNA Pol proofreading are efficient at preventing mutations in short runs. It has been proposed that frameshift intermediates generated in long runs escape Pol proofreading but are correctable by MMR. This would explain the lack of synergy for mutations in long homonucleotide run when proofreading and MSH2, Msh3, or Msh6 mutants are combined Table. Unlike situation with double mutant POL2 - 4 MSH2, POL2 - 4 Msh3, and POL2 - 4 Msh6 strains, synergy was clearly observed for mutations in long homonucleotide run when POL2 - 4 was combined with Exo1 mutation. The Combination of POL2 - 4 and Exo1 led to an increase in mutation rate of up to 55 - fold over that found for either single mutant, consistent with the finding that MMR in eukaryotes may be bidirectional. Since Pol - exonuclease proofreading is absent in long homonucleotide runs, we propose that this synergy is manifestation of both gene products participating in error avoidance. While other mechanisms might be involved, we suggest that Exo1 and Pol exonucleases function in MMR of long homonucleotide runs and compete for substrates when mismatch recognition components are present. Another possibility is that the MMR system is saturated with POL2 - 4 mutant due to accumulation of mismatches. Thus, partial defect in MMR due to loss of Exo1 might lead to a synergistic increase in instability of long homonucleotide runs. However, this contradicts the lack of synergy for mutation of long homonucleotide run in double mutants between POL2 - 4 and either Msh3 or Msh6, which are partially defective in MMR Table. The Propose role for Exo1 and Pol exonucleases could occur if two types of exonucleases participate in excision of mismatches in a manner similar to that found for RecJ and ExoVII 53 exonucleases and Exo1 35 exonuclease in E. Coli MMR. However, in E. Coli RecJ xseA double mutant defective in RecJ and ExoVII is not hypermutable, implying that the system functions efficiently even when restricted to unidirectional mode of action. Recently, Viswanathan and Lovett report that frameshift mutations were stimulated in RecJ Exo1 ExoVII triple mutant, although base substitution mutations were not increased in several assays. This mutator effect was primarily due to synergistic interaction between Exo1 and ExoVII mutations. Base on in vitro data, Longley et al. I have suggested that DNA Pol participate in the MMR at resynthesis step. Our genetic data suggest that DNA Pol proofreading exonuclease may also be directly involved in the excision step of MMR. Similar to DNA Pol proofreading exonuclease, DNA Pol - exonuclease also appears inefficient during replication of homonucleotide run 14, so there is no synergistic interaction between proofreading defects and MSH2. While haploid POL3 - 01 Exo1 strain is inviable, homozygous diploid strain is viable and exhibits strong synergistic mutator interaction both for instability of 14 runs and reversion of his7 - 2.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Discussion

Table

PropertyPol IPol III corePol III holoenzyme
molecules per cell4004010
nucleotides polymerized min-1 (molecule enzyme)-1600900042,000
processivity3-18810>105
5' to 3' polymerase+++
3' to 5' exonuclease, proofreading+++
5' to 3' exonuclease+--

Mtdna deletions underlie many mitochondrial diseases and have also been linked to biological ageing. Most naturally occurring deletions are associated with repeat sequences in MtDNA and different models have been proposed for how these arise 32 33. Less - understood phenomenon is DNA rearrangements observed in patients with MGME1 deficiency. In addition to MtDNA depletion and deletions, this mitochondrial syndrome is also associated with linear, 11 - kb MtDNA fragment that span the entire major arc of MtDNA 34. Interestingly, same type of linear fragments are also seen in mutator Mice, in which exonuclease activity of POL has been inactivated by single amino - acid substitution 30. Ends of linear fragments produced in mutator Mice have been mapped by sequencing of S1 - digest MtDNA products 30. One end map to the D - loop region and the other to the OriL region. Pol exonuclease activity is required for proofreading during MtDNA synthesis. In present work, we have investigated another aspect of this activity: its importance for formation of ligatable ends during MtDNA replication. We demonstrate that inactivation of exonuclease activity will increase strand - displacement activity, that is, DNA synthesis will continue beyond 5 - end of downstream DNA. Entry into the duplex DNA region will lead to the formation of a 5 - flap. As 5 - and 3 - ends of nascent DNA are not properly align, ligase cannot catalyse formation of new phosphodiester bond and seal strand break. In agreement with these in vitro findings, exonuclease - deficient mutator Mice contain high levels of nicked MtDNA molecules. As predicted, these nicks are enriched in H - strand near OriH, site where H - strand DNA synthesis is both initiated and terminate. Failure to ligate H - strand close to OriH will cause problems during the next round of replication. Nick at OriH will not impair initiation of H - strand DNA synthesis, as nick is in non - template strand. However, once the nascent L - strand initiated at OriL reaches nick H - strand DNA at OriH, double - strand break will form. Break will cause formation of linear MtDNA fragments spanning OriH and OriL, as identified in mutator Mice and MGME1 - deficient patients. In contrast to strand - specific nicks observed in the OriH region, similar phenomenon is not observed in OriL. This difference is explained by the strand displacement mode of MtDNA replication, which states that H - strand DNA synthesis precedes and is required for OriL activation. When DNA synthesis initiated at OriL reaches nick in H - strand, double - stranded break is form, causing linear fragment. Therefore, L - strand DNA synthesis events initiated on template with nick in H - strand will not go full circle, which is required for nick formation near OriL. Furthermore, in the more unlikely event that a molecule with nick in L - strand near OriL is form, it cannot be used as a template for subsequent rounds of MtDNA replication. On this nicked template, DNA synthesis initiated at OriH will generate double - strand break at OriL.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

Table2

Functional componentSubunitMass (kDa)GeneActivity or function
Core polymerasea129.9polC=dnaE5' to 3' polymerase
e27.5dnaQ=mutD3'-5' exonuclease
q8.6Stimulates e exonuclease
Linker proteint71.1dnaXDimerizes cores
Clamp loaderg47.5dnaXBinds ATP
(or g complex)d38.7Binds to b
(ATPase)d'36.9Binds to g and b
c16.6Binds to SSB
y15.2Binds to c and g
Sliding clampb40.6dnaNProcessivity factor
* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Materials and Methods

To guarantee faithful DNA synthesis, most replicative DNA polymerases are associated with 3 - 5 exonuclease activity contained in an independent domain of the same polypeptidic chain that removes misinserted Nucleotides before their extension, contributing around two orders of magnitude to global fidelity of the replication process. The exonuclease domain is evolutionarily conserved among those DNAPs from families, B, and C endowed with proofreading activity and consists of a central core of - sheets surrounded by six - helices. Exonuclease active site is constitutes of four invariant aspartates belonging to motifs Exo I, Exo II, and Exo III, which coordinate two metal ions responsible for hydrolysis of last phosphodiester bond, and conserve tyrosine residue of Exo III motif, which bind and orients water molecule, as attacking nucleophile. To allow efficient removal of any misinserted nucleotide, mismatch primer 3 - end has to be firmly stabilized at 3 - 5 exonuclease active site. Such stabilization relies on widely conserved threonine residue of Exo I motif that interacts with 3 - OH at the primer terminus, and on invariant asparagine and phenylalanine residues at Exo II motif that make contact with two 3 - terminal Nucleotides. 30 - to 40 - separation between polymerization and exonuclease active sites imposes fine - tuned functional coordination between both activities during polymerization to ensure faithful and efficient DNA synthesis. Under favorable conditions, 3 - end of growing strand must be preferentially stabilized at polymerization active site to allow multiple elongation cycles. Eventually, misinsertion of 2 - deoxynucleoside - 5monophosphate provokes a drastic drop in elongation catalytic rate, mainly due to defective nucleolytic attack of mismatched 3 - end on next incoming nucleotide. In addition, terminal mispair provokes disruption of contacts with minor groove hydrogen acceptors at polymerization site, favoring melting of 3 - end and its further transference to and stabilization at 3 - 5 exonuclease active site, where hydrolysis reaction occurs and only mismatched nucleotides must be remove. Such transference of primer terminus from POL site to Exo site can take place intramolecularly, as described in replicative DNAPs from bacteriophages T4 and T7 and in adenovirus DNAP. In other DNAPs, proofreading activity requires previous dissociation of DNAP / DNA complex and further binding of 3 - terminus at exonuclease active site, as described in E. Coli POL I and mitochondrial POL. Bacteriophage 29 DNAP belongs to family B of DNA - dependent DNAPs, is the sole enzyme responsible for viral DNA replication, and has served for decades as a model to determine the role of conserved residues responsible for both polymerization and exonuclease activities. This monomeric 67 - kDa enzyme consists of the N - terminal exonuclease domain that contains catalytic residues involved in proofreading and the C - terminal polymerization domain.


DISCUSSION

Most DNA - dependent DNA polymerases have intrinsic 3 - 5 exonuclease activity to prevent nucleotide misincorporation errors during polymerization. This proofreading activity improves fidelity of DNA replication. Crystallographic analysis of the structure of several polymerases shows that active sites for polymerization and 3 - 5 exonucleolysis are spatially distant. Despite the fact that both catalytic sites are separate, they must act in concert to achieve productive and accurate replication reaction 9 20 22 23 27 28 29 30. Low catalytic constant exhibited by replicative DNA polymerases to elongate mispaired 3 terminus allows melting of two strands and further switching of 3 end from polymerization to exonuclease site. Once 3 nucleotides are released, primary end goes back to Pol site to resume polymerization. 29 DNA polymerase is an outstanding enzyme that, unlike most replicases, is able to replicate 29 genomes without unwinding proteins and processivity factors, due to its high processivity and strand displacement activity 4. Resolution of its crystallographic structure allows us to identify several hydrophilic residues of the exonuclease domain, as Tyr101 and Thr189, that have been predicted to interact with single stranded template stabilizing polar groups of nucleotides by interacting with backbone through water - mediate and direct hydrogen bonds. Additionally, Tyr101 stacks with sugar of + 1 nucleotide of template 19. Our results show that mutants Y101A and T189A are unable to stabilise DNA in the polymerization domain, and in the case of mutant Y101A, it shows a distributive pattern of polymerization in agreement with its role as template strand binding residue. This reduced processivity together with affected stabilization of template / primer at polymerization active site impairs replication of complete length of template, possibly due to prompt dissociation from DNA when the size of template is short, affecting termination of DNA replication. Nearly wild - type phenotype exhibited by mutant Y101F would strengthen the importance of stacking interaction between Tyr101 and sugar moiety of + 1 nucleotide rather than propose polar interaction with nucleotide backbone 19. In addition, mutant Y101A exhibits strongly reduced exonuclease activity. Such defect could be explained by disappearance of stacking interaction with DNA but also by lack of contact with Lys124. This lysine interacts with Asp121 that has been described as essential for proper positioning of primer end at Exo site 31. Polymerase mutants at residue Thr189 show reduced exonuclease activity compromising the editing function of the enzyme, mainly T189A mutant that was able to produce stable incorporation of incorrect nucleotides during polymerization, affecting fidelity of polymerization. The phenotype displayed by mutant T189S is similar to that of wild - type enzyme, in contrast to the phenotype exhibited by mutant T189A. This could be evidencing role of the hydroxyl group of threonine in interaction with DNA.


INTRODUCTION

Dna and RNA nucleases are hallmark of the growing number of cell signalling cascades including DNA damage response and immune diversification. They dictate many DNA repair pathway choices by controlling DNA damage substrates created that dictate downstream options during signalling cascade. Complex roles DNA and RNA nucleases play in DNA repair pathways underpin several premature ageing -, immune -, and tumour - related syndromes. All of these can result from aberrations in structural and / or catalytic functions of DNA and RNA nucleases. Despite their importance, activities of numerous human DNA nucleases are still debate. There are also several yet uncharacterised proteins harbouring predicted nuclease domains in mammalian genomes 5 6 7 8. Even with their myriad and complex functions, DNA / RNA nucleases can be broadly defined by their substrate specificity, directionality of resection, and processivity. Significant restrictive limitation in nuclease studies has been adequate identification of their catalytic functions and / or their relative activities against differing DNA / RNA intermediates. Conventional nuclease assays predominantly involve use of radioactive labelling to visualise DNA substrates on agarose gel 9 10 11. Use of radioactive isotopes delivers highly specific, sensitive assays that are free from interference. However, these assays are often inefficient, time - consuming, qualitative, and potentially hazardous 12 13. Additionally, assays are discontinuous, and must be stopped at discreet, often arbitrary, time points before measuring readouts 14. Whilst this can provide an indication of reaction rate, it does not allow for real - time visualisation of catalytic resection activity. Radiolabelled oligonucleotides are gradually being replaced with fluorescent nucleic acid stains such as DAPI 15 and other commercially - available dyes including, but not limited to, Midori Green, SYBR Green I and Acridine Orange 16. Picogreen is a commercially available dye that emits fluorescent signal upon intercalation with double - strand DNA, emitting fluorescent signal 1 000 - folds stronger compared to when it is free in solution. In comparison, Quant - It mircoRNA assay dye can specifically recognise short RNAs and other nucleic acids. Superior sensitivity can quantify picogram or nanogram levels of dsDNA, respectively, unlike other fluorescent dyes, including Hoechst 17, ethidium bromide 17, EvaGreen 18, SYBR Green 18 and YOYO - 1 18. Several other sophisticated fluorescent techniques have been devise, building upon use of FRET, whereby fluorescence is either quenched or dequenched following nuclease activity 19. Methods involving graphene oxide surfaces 20, electrochemical redox reactions 21 22 23, complexing of DNA with polycationic polymer 24, or immobilising nucleotides on magnetic beads 25 have also been develop. While highly sensitive, these methods have been designed purely for detection of very limited number of DNA and RNA nucleases rather than for their characterisation 26. Similar to other nucleic acid dyes, PG has proven to be a versatile DNA stain in different experimental conditions. Pg has been used to visualise dsDNA in agarose electrophoresis as a quality control marker to identify fragmented and nicked DNA 27. It has also been implemented in flow cytometry analysis of cell - free DNA which can increase in certain pathologies, such as cancer and autoimmune syndromes 28.


Polymerase/3-5 exonuclease (pol/exo) coupled assay

Exonuclease activities of purified recombinant Ecoli and human NDKs were tested with standard 30 - mer single - strand oligonucleotide, 5 - CTCGTCAGCATCATGATCATACAGTCAGTG - 3. To verify substrate specificity, various oligonucleotide substrates were test. Oligonucleotide sequences were 5 TTGAGGCAGAGTCC, 5 GGACTCTGCCTCAA, 5 GGACTCT - GCCTCAAG, 5 GGACTCTGCCTCAAGACG, 5 CACGTTGACTA - CCGTC, 5 GGACTCTGCCTCAAGACGGTAGTCAA - CGTG, and 5 GATGTCAAG - CAGTCCTAAGTTTGAGGCAGAGTCC. 5 end - labeling of each top strand was carried out with T4 polynucleotide kinase and 32 P - ATP. End - label oligonucleotides were annealed to their complementary bottom strands in the annealing buffer. Standard assay was performed in 30 L volume with reaction buffer, 5 pmoles DNA, and E. Coli or human NDKs at 37C for 1 hour. Exonuclease activity of human NDK1 mutants was tested with 5 end - label single - strand 30 - mer in standard assay as described above. For competition assays between wild type and catalytically inactive mutants, 0. 5 - 5 g of human NDK1 mutants E5A, E5Q, E129A, and E129Q, were preincubated with 5 end - label single - strand 30mer in reaction buffer at room temperature for 20 min. After adding 0. 5 g of wild type protein, additional reaction was carried out at 37C for 30 min. Reaction was terminated by phenol / chloroform extraction and ethanol precipitation. The DNA pellet was dissolved in formamide loading dye. Cleavage of oligomers was analyzed by 16% denaturing polyacrylamide gel electrophoresis. To test processing of substrates containing modified bases, double strand oligonucleotides containing U / or Tg / pairs were used. 30 - mer top strand oligonucleotides were 5 - CTCGTCAGCATCA - GATCATACAGTCAGTG - 3, where U or Tg stands for uracil and thymine glycol, respectively. 5 - label top strands were annealed to bottom strands and double strand oligonucleotides containing uracil were first incubated with E. Coli UDG or human UDG for 20 min at 37C. After directly adding human APE1, mixtures were incubated for an additional 20 min at 37C. Reaction mixtures were split into two further reactions with hNDK1, direct incubation with hNDK1 or incubation with hNDK1 after removing UDG and hAPE1 by phenol / chloroform extraction and ethanol precipitation. Samples were incubated for an additional 30 min at 37C. Cleave DNA was analyzed as described above.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Introduction

Error - free DNA replication is essential for maintaining genome stability and for preventing accumulation of mutations, which drive carcinogenesis. Replication fork blockage interferes with cell division and contributes to genome instability. Different sources of replication stress can impede fork progression, eg, lack of deoxynucleotide triphosphates, or obstacles in template strand. Various mechanisms have evolved to deal with these sources of replication stress. Homologous recombination is a well - studied mechanism involved in repair of DNA double - strand breaks. In HR, DNA is repaired through invasion of broken DNA strand into homologous DNA duplex followed by copy synthesis. Before the strand invasion takes place, 5 DSB ends are resect to create 3 single - strand overhangs. One of the proteins responsible for end resection is MRE11, part of the MRE11 / Rad50 / Nbs1 complex. Mrn is highly conserved among eukaryotes and is, together with CtIP, involved in a wide range of early responses to DNA damage, often mediated by its role in DNA end processing. Central to DNA end processing are MRE11 single - strand Endonuclease and 3 to 5 Exonuclease activities. The role of MRE11 Exonuclease activity in HR has long been enigmatic, as 3 to 5 polarity is in the opposite direction of 5 to 3 resection required for HR. More recently, several studies suggest that MRE11 Endonuclease activity creates single - strand nicks, which serve as entry points for MRE11 3 to 5 Exonuclease activity direct toward break, while other activities are responsible for resection away from break. After resection, invasion of 3 ends of DSB into homologous DNA is mediated by RAD51, aid in humans by BRCA1, BRCA2, and several RAD51 paralogues. Invading 3 end acts as primer for copy synthesis. Several MRE11 functions are independent of its nuclease activities. Saccharomyces cerevisiae MRE11 nuclease - deficient mutants are only partially sensitive to ionizing radiation and are proficient for several other phenotypes observed in MRE11 null mutants. In Schizosaccharomyces pombe, resection of C - rich strand at telomere ends requires MRE11 but is independent of its nuclease activities,. While MRE11 nuclease mutant is defective in Rec12 Spo11 removal and shows sensitivity to topoisomerase poisons but not to methyl methanesulfonate and ionizing radiation. Mrn / CtIP and other proteins involved in HR have also been implicated in restart of stalled replication forks after they encounter obstacles in template strand. The precise role of the MRN complex, and especially the role of MRE11 nuclease activity in replication fork restart, is not understood. S. Cerevisiae MRE11 is recruited to pause replication forks and stabilize their association with replisome components, but this function does not depend on MRE11 nuclease activity. In S. Pombe, enrichment of HR protein RAD52 at stall forks is dependent on MRN complex but is independent of MRE11 nuclease activity. In absence of some HR proteins in human cells, MRE11 Exonuclease activity is responsible for uncontrolled deleterious degradation of stall and reverse forks.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Exonuclease VIII/RecE

Many DNA viruses require DNA replication not only for synthesizing genomes, but also for generating substrates with correct topologygenomic concatemersfor packaging into infectious viral particles. Under conditions in which replication is inhibited but multiple copies of viral genome are present, recombination can take over conversion of monomeric genomic molecules into concatemeric arrays required for packaging. In double - strand DNA viruses with linear genomes, exemplified by well - studied phage,s typical infection begins with injection of linear viral DNA into the host, where it takes on circular conformation. These unit - length molecules replicate in theta mode but cannot be package, since they possess single packaging site. Later in infection, replication switches to sigma mode, producing genomic concatemers with multiple cos sites. Packaging endonuclease cleaves cos and positions empty viral capsid at one of the nascent DNA ends. Dna is pumped into capsid until one genome length of DNA is encapsidated and a second cos site is encounter. Packaging is complete when Ter is bound to fill capsid cleaves DNA at second cos site and fill capsid dissociates from Ter. The general strategy of viral genome packaging by encapsidation of headful of DNA cleave from concatemeric array of viral genomes is conserved among linear dsDNA viruses, including herpesviruses, baculovirus, and phage SPP1, and is absolutely dependent upon production of genomic concatemers. As genome concatemerization is essential for viral growth, alternate pathway to concatemerization is provided by homologous genetic recombination. Recombination is promoted by dsDNA ends created by cleavage of packaging site by packaging endonuclease and at tips of rolling circle replication intermediates. The resulting recombinant product can contain more than one genome equivalent of DNA and at least two packaging sites and can therefore be package. In phage, two enzymes, Exonuclease and beta protein, catalyze homologous recombination. Exo is alkaline exonuclease, and beta protein is a synaptase. Exo and beta protein form a specific 1: 1 complex and work together as two - component viral recombinase. Search of the nonredundant GenBank database using PSI - BLAST server with Exo as query sequence revealed over 80 other Exo - like proteins from linear dsDNA viruses, with similarity being limited to five conserved amino acid motifs. The group of proteins has been variously named Red superfamily and LE family. For many of know or putative exonuclease genes, nearby gene for know or putative synaptase has been identify. Unlike viral nucleases, which all resemble Exo, synaptases fall into several families. Whereas synaptase sequences are diverse, their structures are very similar, and they assemble into nucleoprotein filaments with ssDNA. Two - component recombinase pairs include Exo / beta protein from coliphage, RecE / T from Rac prophage of E.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Exonuclease X

Exonuclease X was discovered as an open reading frame with predicted similarity to the DnaQ family of 3 to 5 exonucleases. Purification and characterization of 25 kD protein demonstrate it possesses Mg 2 + - dependent 3 to 5 Exonuclease activity on both single - strand and dsDNA substrates, with preference for the former. Despite the fact that the enzyme is distributive, it has a fairly rapid catalytic rate of 1400 nt / min / monomer on ssDNA. The K D of protein for ssDNA is 2 nM, confirming a very strong affinity for ssDNA. Rna does not act as a competitive inhibitor of exonuclease activity, suggesting the protein is specific for DNA substrates. Exonuclease X is a member of the DnaQ or DEDD superfamily and is most homologous to the proofreading activity of PolC from gram - positive bacteria and to mammalian TREX1 protein implicated in autoimmune disorders, with which it shares many mechanistic features. Exox purifies as homodimer, similar to RNase T, another member of the family. There is no crystal structure of protein, although structures for TREX1 may provide some insights. The mutant in Exonuclease X had little phenotype on its own but effects can be seen in combination with other ssDNA exonucleases. Loss of ExoX with ExoI in recD mutants of E. Coli causes 100 - fold decrease in recombinants detected after conjugation, suggesting a role in recombination secondary to ExoI, revealing when nuclease activity of RecBCD is impair. Exox, in combination with RecJ and ExoI, plays a role in promoting genetic stability by aborting deletion between tandem repeat sequences. In the absence of these three exonucleases, deletion rate between adjacent 100 bp repeats is elevated to about 20 - fold. Quadruple mutants in RecJ, ExoI, ExoVII and ExoX are UV - sensitive, cold - sensitive for growth and exhibit modest mutator phenotype, epistatic to MutS, suggesting deficiency in mismatch repair. Confirming this, cell extracts from RecJ ExoI VII X mutant are devoid of mismatch repair capacity. Consistent with the known polarity of these enzymes, either RecJ or Exo VII can support mismatch repair from nick 5 from mismatch whereas ExoI, ExoX and, to a lesser extent, ExoVII can support repair from 3 direction.S Ssexo mutants are sensitive to 2 - aminopurine, which increases load of mismatches in the cell; this sensitivity can be suppressed by mutations blocking earlier steps in mismatch repair, including MutL, MutS or UvrD. This finding and relatively weak mutator phenotype have been attributed to the notion that attempts at mismatch correction in the absence of exonucleases are lethal. The mechanism of cold - lethality of strain is not fully understood, but it can be relieved fully by mutations in DNA helicase UvrD and partially by upstream mutations in mismatch repair pathway, MutS, MutH and MutL. Displacement of ssDNA by UvrD, in part in response to mismatch correction, appears to be lethal in the absence of ssDNA exonucleases.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

RNase T (Exonuclease T)

Rnase T was initially identified as an RNA exonuclease removing terminal AMP residue of tRNA molecules; it also removes two terminal residues during maturation of 5S rRNA. Gene encoding RNase T was identified as a high - copy suppressor of UV sensitivity in mutants of ssDNA exonucleases, RecJ ExoI and ExoVII, implicating a potential role as DNA exonuclease. Rnase T appears to compensate specifically for ExoI in such strains, since it does not suppress RecJ xseA double mutants. Rnase T overexpression also appears to support UV survival of strains deficient in nucleotide excision repair, uvrA or uvrC. Rnase T has robust exonuclease activity on long ssDNA substrates, degrading in 3 to 5 polarity dependent on Mg 2 + or Mn 2 +. Only very weak degradation was observed on DSDNA. Its K M for ssDNA was 5 nM in contrast to the reported K M for tRNA of 14 M. Although its mechanism was nonprocessive, RNase T could extensively degrade ssDNA, as much as 30 000 bases on a single molecule, in comparison to its limited degradation of tRNA or rRNA. For RNA, cytosine residues in particular appear to inhibit degradation. A higher affinity for ssDNA over RNA was confirmed in the second study using oligonucleotide substrates. Rnase T will produce blunt ends from 3 ssDNA overhangs, such as those produced by restriction endonucleases. It has been reported that like its RNase activity, RNase Ts DNase activity requires dimerization. Rnase T is a member of the DEDD DnaQ superfamily of 3 exonucleases. Mutation in these conserved motifs is required for RNase activity. Crystal structure confirms resemblance to proofreading 3 exonucleases and to other members of this family such as ORN and RNase D. Catalytic and substrate binding residues are contributed by separate molecules AT dimer interface, explaining why dimer formation is essential for function.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

TatD (Exonuclease XI?)

E. Coli TatD is an Mg 2 + - dependent 3 - 5 Exonuclease specific for single - strand DNA and RNA. Gel filtration profile of full - length TatD showed that the enzyme was elute as monomeric Protein. Tatd was incubated with 5 end 32 P - label 20 - nucleotide ssDNA for 1 H at 37C. Tatd cleaves DNA most efficiently in the presence of Mg 2 + or Mn 2 + whereas TatD had no nuclease activity in the presence of Ca 2 + or Zn 2 +. Final cleaved products were small DNA of less than six nucleotides. Tatd produces a ladder pattern of digested products in digesting 5 end 32 P - label ssDNA whereas it produces a single band of 3 - 32 P - NMP in digesting 3 - 32 P - label DNA. Tatd could not digest 3 - biotin - bound DNA in the presence of streptavidin, which blocks access to TatD from 3 end. Tatd prefers to digest single - strand DNA / RNA over double - strand DNA / RNA. Tatd digests 3 overhang of duplex DNA to generate the final product of duplex with 2 - nucleotide 3 overhang. The number of nucleotides in 3 overhangs is marked on the right of the gel.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Sources

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

logo

Plex.page is an Online Knowledge, where all the summaries are written by a machine. We aim to collect all the knowledge the World Wide Web has to offer.

Partners:
Nvidia inception logo

© All rights reserved
2021 made by Algoritmi Vision Inc.

If you believe that any of the summaries on our website lead to misinformation, don't hesitate to contact us. We will immediately review it and remove the summaries if necessary.

If your domain is listed as one of the sources on any summary, you can consider participating in the "Online Knowledge" program, if you want to proceed, please follow these instructions to apply.
However, if you still want us to remove all links leading to your domain from Plex.page and never use your website as a source, please follow these instructions.