Advanced searches left 3/3
Search only database of 8 mil and more summaries

Positive Genetic Mutations In Humans

Summarized by PlexPage
Last Updated: 02 July 2021

* If you want to update the article please login/register

General | Latest Info

No; only a small percentage of mutations cause genetic disordersamost have no impact on health or development. For example, some mutations alter a gene's DNA sequence but do not change the function of protein made by the gene. Often, gene mutations that could cause genetic disorder are repaired by certain enzymes before a gene is expressed and an altered protein is produce. Each cell has a number of pathways through which enzymes recognize and repair errors in DNA. Because DNA can be damaged or mutate in many ways, DNA repair is an important process by which the body protects itself from disease. A very small percentage of all mutations actually have a positive effect. These mutations lead to new versions of proteins that help an individual better adapt to changes in his or her environment. For example, beneficial mutation could result in protein that protects individuals and future generations from new strains of bacteria. Because a person's genetic code can have LARGE number of mutations with no effect on health, diagnosing genetic conditions can be difficult. Sometimes, genes thought to be related to particular genetic condition have mutations, but whether these changes are involved in development of condition has not been determine; these genetic changes are known as variants of unknown significance or. Sometimes, no mutations are found in suspected disease - related genes, but mutations are found in other genes whose relationship to particular genetic condition is unknown. It is difficult to know whether these variants are involved in disease. The University of Utah Genetic Science Learning Center provides information about genetic disorders that explains why some mutations cause disorders but others do not. The National Human Genome Research Institute provides information about human genomic variation. Cold Spring Harbor National Laboratoryas DNA From Beginning explains the discovery of DNA repair mechanisms in cells and introduces researchers who work to understand these mechanisms. Force explains the significance of variants of unknown significance in cancer.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

The Unusually Well

Table

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProGluGluLysSerAlaValThr
ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProValGluLysSerAlaValThr

Because so many chronic illnesses dont manifest until later in life, unusually healthy elderly are one good place to start searching for protective mutations. There have been few hypotheses about why some people live such long, healthy lives, says Nir Barzilai of Albert Einstein College of Medicine. One was that these guys have perfect genome; they just do have any of the mutations that are associated with disease, he say. Another was that theyre all lean, nonsmoking vegetarians. Recent studies quash both these theories. Last year, Barzilais group analyzed 44 full genome sequences from centenarians. In total, group had 250 mutations linked to Parkinsons, Alzheimers, cardiovascular Disease, and other chronic conditions, scientists report in Molecular Genetics and Genomic Medicine. Moreover, some hundred - year - olds were obese, others had been lifelong smokers, and many had never regularly exercise. However, they all lived century, and none had developed signs of chronic disease. That leaves us with the fact that they must have some genomic reasonsother than lack of disease genesfor their longevity, says Barzilai. Shortly after Barzilais Study was publish, NHGRI researchers led by Biesecker analyzed protein - coding genes, or exomes, of 951 healthy adults and found that 1 in 10 had mutations linked to Parkinsons, heart defects, and blood disorders, among other things. These are gene variants that do just increase disease risk but are thought to always cause disease. But half of those people were not ill. Despite such tantalizing clues, searches for protective mutations that could be offsetting effects of disease - link genes and lifestyle factors have been hit and miss so far. In 2007, Eric Topol of Scripps Institute and his colleagues, eager to look at concentrated collection of healthy genomes, began recruiting people over the age of 80 who didnt have chronic diseases and were on medications, as part of the Scripps Wellderly Project. Over the next 7 years, they will develop a cohort of 1 400 so - called Wellderly. In 2014, they published full genomes of 454 participants in an open - access database for researchers anywhere in the world to use. So far, no protective mutations have been turned up. But the hunt is on, Topol say. Over a similar period, Barzilai, keen to focus on relatively homogeneous population to facilitate discovery of genetic variants, Study Ashkenazi Jews over the age of 95. Barzilais LonGenity Project has collected genetic and health information from over 500 of these extreme elderly as well as 700 of their offspring. Even before theyd completed full genomes of their centenarians, Barzilai and his colleagues had turned up two promising gene variants. Deletion in adiponectin gene ADIPOQ, they find, appears to protect against inflammation of arteries. And mutation in cholesteryl ester transfer - protein gene CETP was seen more often in older cohort, and was linked to protection against both high cholesterol levels and cognitive disorders.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Pathways to Therapeutics

Wellderly, there is only one harboring potential genetic gems; examining infectious disease survivors offers another promising avenue. Wherever there is a profound infectious disease infecting the community, looking at survivors enables you to look for resistance genes which may cast enormous light on the etiology of disease and potentially lead to new treatment, says neurologist John Collinge of University College London. Researchers, for example, are investigating drugs to fight the Ebola virus that target protein known as Niemann Pick type C. Genes that encode it, when mutate, cause rare version of Niemann Pick Disease that is usually fatal in childhood to people with two copies. But in animal studies, individuals with only one mutated copy of gene resist Ebola infection because the virus needs a working version of protein to infect host cells. In other recent research, investigators have looked for gene mutations that protect against infection, or severe illness from influenza and other pathogens. In October, researchers with MalariaGEN international consortium identified a gene variant that affects blood cell surface receptor and protects against severe cases of malaria. Collinge and his colleagues have been studying survivors of more exotic epidemic: kuru, deadly neurological illness similar to Creutzfeld Jakob Disease. Like CJD, kuru is transmitted by misshapen proteins called prions, and, in the 1950s and 1960s, it spread rapidly among members of cannibalistic tribe in Papa New Guinea. When someone dies of kuru, ritualistic consumption of their body means that those participating in the ceremony would contract the disease too. In some villages, almost all women of childbearing age perish. But decades later, there were also survivorspeople who partaken in feasts and never got sick. In the early 1990s, Collinge began sequencing their genomes. Over the past two decades, hes revealed mutations in their prion protein gene, PRNP, that protect them from kuru. In those families with polymorphism, there is hardly any kuru despite very high levels of exposure, says Collinge. This year, Collinge and his colleagues report in Nature that mice with one of the mutations were protected from 18 different kinds of prion disease. This particular finding is incredibly powerful, says Collinge. We go from 100 percent of mice dying to 0 percent. Now, researchers are working on determining the structure of protective risk and protection are really just flip sides of the same coin. Sekar Kathiresan prion proteins, which could shed light on how to mimic mutations in the rest of the human population, possibly leading to treatments for not just kuru but a variety of prion diseases. Ideally, discovery of protective mutation could inform development of drugs that mimic its molecular effects in the body. Inhibitors of CETP, studied by Barzilai, have been explored as cholesterol drugs, although none has reached the market.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

A Struggle Against Statistics

While resistance alleles can provide fitness advantage, there are several reasons why particular allele might not become fixed. One reason may be the phenomenon of heterozygous advantage as is demonstrated by sickle cell allele having greatest fitness in heterozygotes due to their lack of sickle cell disease and protection against malaria. Heterozygous advantage is just one of the mechanisms of balancing selection whereby diversity at locus is maintain. Interestingly, evidence of balancing selection extends to additional malaria resistance loci: cluster of erythrocyte membrane proteins associated with resistance to severe malaria on ancient haplotypes shared with chimpanzees suggests host - pathogen struggle of primates with malaria may extend back millions of years. Diversity in this case may be being maintained through host - pathogen arms race with host targets and parasite binding protein escalating conflict through maintaining genetic diversity. In other cases, fixation of resistance alleles may simply need more time, requiring hundreds of generations or more to occur. The rate of fixation depends on fitness detriment of disease, fitness benefit conferred from allele of interest, and whether resistance allele is additive, dominant, or recessive. Selective forces may also fluctuate over timepandemics end and may be followed by new pathogens for which the same genetic variant may now have different effect. For example, CCR5 - 32 is protective against HIV infection but is conversely a risk factor for severe West Nile infection. Similarly, although the O blood type protects against severe malaria, it also confers susceptibility to severe cholera.


What causes LFS?

Lfs is a hereditary genetic condition. This means that cancer risk can be passed from generation to generation in family. This condition is most commonly caused by mutation in a gene called TP53, which is the genetic blueprint for a protein called p53. Mutation takes away genes ' ability to function correctly. Approximately 70% of families with LFS will have mutation in the TP53 gene. Mutations in the TP53 gene are also found in 22% of families who have Li - Fraumeni - like Syndrome by Definition 1 and in 8% of families who have LFL by Definition 2. Mutations in another gene, called CHEK2, have been found in some families with LFS. It is not know whether cancer risks are the same in families that have TP53 mutations and CHEK2 mutations. However, with increase in multiple - gene panel testing, many carriers of CHEK2 mutations are being identify, most with far less incidence of cancer in their family histories than with LFS. Research is ongoing to identify other genes associated with LFS and LFL.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

1. Introduction

Table

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProGluGluLysSerAlaValThr
ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProValGluLysSerAlaValThr

Gene Mutation is permanent alteration in DNA sequence that make up gene, such that sequence differs from what is found in most people. Mutations range in size; they can affect anywhere from single DNA building block to large segments of the chromosome that include multiple genes. Hereditary mutations are inherited from parents and are present throughout personas life in virtually every cell in the body. These mutations are also called germline mutations because they are present in the parentas egg or sperm cells, which are also called germ cells. When egg and sperm cell unite, resulting fertilized egg cell receives DNA from both parents. If this DNA has a mutation, child that grows from a fertilized egg will have mutation in each of his or her cells. Acquire mutations occur at some time during personal life and are present only in certain cells, not in every cell in the body. These changes can be caused by environmental factors such as ultraviolet radiation from the sun, or can occur if error is made as DNA copies itself during cell division. Acquire mutations in somatic cells cannot be passed to the next generation. Genetic changes that are described as de novo mutations can be either hereditary or somatic. In some cases, mutation occurs in personas egg or sperm cells but is not present in any personas other cells. In other cases, mutation occurs in fertilized egg shortly after egg and sperm cells unite. As the fertilized egg divides, each resulting cell in the growing embryo will have mutation. De novo mutations may explain genetic disorders which affect children have mutation in every cell in the body but parents do not, and there is no family history of disorder. Somatic mutations that happen in single cell early in embryonic development can lead to a situation called mosaicism. These genetic changes are not present in the parentas egg or sperm cells, or in fertilized egg, but happen a bit later when the embryo includes several cells. As all cells divide during growth and development, cells that arise from cell with altered genes will have mutation, while other cells will not. Depending on the mutation and how many cells are affect, mosaicism may or may not cause health problems. Most disease - causing gene mutations are uncommon in the general population. However, other genetic changes occur more frequently. Genetic alterations that occur in more than 1 percent of the population are called polymorphisms. They are common enough to be considered normal variation in DNA. Polymorphisms are responsible for many normal differences between people, such as eye color, hair color, and blood type. Although many polymorphisms have no negative effects on personas health, some of these variations may influence the risk of developing certain disorders. The Centre for Genetics Education provides fact sheets discussing variations in genetic code.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

2. Mutations

Table

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProGluGluLysSerAlaValThr
ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProValGluLysSerAlaValThr

Mutations are caused by physical changes to hereditary material And, because DNA is a long sequence of base pairs organized into physically unlinked chromosomes, there are many possible ways it can change. There are point mutations that change only single letter and lead to so - called single nucleotide polymorphisms in populations, insertions and deletions of various sizes, transpositions that move sequence from one position to another, and can thereby cause mutations at boundaries, inversions of various sizes that change orientation of stretch of DNA, chromosome mutations that affect long enough pieces of DNA to become visible under microscope and might even lead to loss or duplication of whole chromosome, and changes in ploidy level, where whole copy of Genome is either gain or lose. A special class of mutations are caused by transposable elements. As reviewed in this themed issue by Lee & Langley, there are various types of these elements that can move around in Genome and can copy, insert or excise themselves, sometimes in response to conditions such as stress. Mechanisms exist to control the frequency of transposition events to limit damage from resulting deleterious mutations. At each level, biochemical factors are such that some types of changes occur more frequently than others. For example, in many species there are many more transitions than transversions, methylation of CpG sites in mammals leads to about tenfold higher mutation rates at these sites and the ratio of insertions to deletions can differ among species. Mutation rates are difficult to measure because events are so rare that it is like measuring the frequency of needles in haystacks. Historically, this has been accomplished mainly by finding single genes or groups of genes that lead to phenotypic changes that can easily be observed in populations with known descent and extrapolating to level of genomes. As Kondrashov & Kondrashov point out in their contribution to this issue, recent advances in post - genomic Sequencing technology have led to breakthroughs that now allow direct determination of mutation rates in species with sequenced genomes, work which Charlesworth has stimulated by his developments of theory and to which he has contribute directly. Future work in this area is important because accurate estimates of mutation rates at different sites and in different species can be important for testing alternative theories. Mutations are frequently classified as non - synonymous or synonymous according to whether or not they change amino acid sequence, which depends entirely on the function of the mutated base pair. They are easy to recognize and so are frequently used in population genetic tests. They provide useful rules of thumb: eg synonymous sites often evolve neutrally or under weak selection and non - synonymous sites are often under strong purifying selection, even if its strength is difficult to quantify.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Sickle Cell

Table

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProGluGluLysSerAlaValThr
ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProValGluLysSerAlaValThr

Although the haploid Human Genome consists of 3 billion nucleotides, changes in even a single base pair can result in dramatic physiological malfunctions. For example, sickle - cell anemia is a disease caused by the smallest of genetic changes. Here, alteration of single nucleotide in gene for the beta chain of hemoglobin protein is all it takes to turn normal hemoglobin gene into sickle - cell hemoglobin gene. This single nucleotide change alters only one amino acid in the protein chain, but the results are devastating. Beta hemoglobin is a single chain of 147 amino acids. As previously mention, in sickle - cell anemia, gene for beta globin mutate. The resulting protein still consists of 147 amino acids, but because of single - base mutation, sixth amino acid in the chain is valine, rather than glutamic acid. This substitution is depicted in Table 1. Molecules of sickle - cell hemoglobin stick to one another, forming rigid rods. These rods cause person's red blood cells to take on a deformed, sickle - like shape, thus giving the disease its name. Rigid, misshapen blood cells do not carry oxygen well, and they also tend to clog capillaries, causing affected person's blood supply to be cut off to various tissues, including the brain and heart. Therefore, when an afflicted individual exerts himself or herself even slightly, he or she often experiences terrible pain, and he or she might even undergo heart attack or strokeall because of single nucleotide mutation. Sickle - cell anemia is one of hundreds of life - threatening disorders that are know to be caused by change in just one of those 3 billion A's, T's, C's, or G's. Because so many diseases are associated with mutations, it is common for mutations to have negative connotation.S However, while many mutations are indeed deleterious, others are silent; that is, they have no discernible effect on the phenotype of an individual and remain undetected unless molecular biologists take DNA samples for sequence analysis. In addition, some mutations are actually beneficial. For example, very same mutation that causes sickle - cell anemia in affected individuals can confer survival advantage to unaffected carriers when these people are challenged with malaria pathogen. As a result, sickle - cell mutations persist in populations where malaria is endemic. Beyond individual level, perhaps the most dramatic effect of mutation relates to its role in evolution; indeed, without mutation, evolution would not be possible. This is because mutations provide raw material upon which mechanisms of natural selection can act. By way of this process, those mutations that furnish individual organisms with characteristics that better adapt to changing environmental conditions are passed on to offspring at an increased rate, thereby influencing the future of species. While mutation is defined as any alteration in DNA sequence, biologists use the term single nucleotide polymorphism to refer to single base pair alteration that is common in the population.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Beyond good and bad

Mutations are changes in genetic sequence, and they are the main cause of diversity among organisms. These changes occur at many different levels, and they can have widely differing consequences. In biological systems that are capable of reproduction, we must first focus on whether they are heritable; specifically, some mutations affect only the individual that carries them, while others affect all of the carrier organism's offspring, and further descendants. For mutations to affect organism's descendants, they must: 1 occur in cells that produce the next generation, and 2 affect hereditary material. Ultimately, interplay between inherit mutations and environmental pressures generates diversity among species. Although various types of molecular changes exist, word mutation typically refers to changes that affect nucleic acids. In cellular organisms, these nucleic acids are building blocks of DNA, and in viruses they are building blocks of either DNA or RNA. One way to think of DNA and RNA is that they are substances that carry long - term memory of information required for organism's reproduction. This article focuses on mutations in DNA, although we should keep in mind that RNA is subject to essentially the same mutation forces. If mutations occur in non - germline cells, then these changes can be categorized as somatic mutations. The word somatic comes from the Greek word soma, which means body, and somatic mutations only affect the present organism's body. From an evolutionary perspective, somatic mutations are uninteresting, unless they occur systematically and change some fundamental property of an individual - such as capacity for survival. For example, cancer is a potent somatic mutation that will affect a single organism's survival. As different focus, evolutionary theory is mostly interested in DNA changes in cells that produce the next generation. The statement that mutations are random is both profoundly true and profoundly untrue at the same time. The true aspect of this statement stems from the fact that, to the best of our knowledge, consequences of mutation have no influence whatsoever on the probability that this mutation will or will not occur. In other words, mutations occur randomly with respect to whether their effects are useful. Thus, beneficial DNA changes do not happen more often simply because organisms could benefit from them. Moreover, even if an organism has acquired beneficial mutation during its lifetime, corresponding information will not flow back into DNA in the organism's germline. This is fundamental insight that Jean - Baptiste Lamarck got wrong and Charles Darwin got right. However, idea that mutations are random can be regarded as untrue if one considers the fact that not all types of mutations occur with equal probability. Rather, some occur more frequently than others because they are favor by low - level biochemical reactions. These reactions are also the main reason why mutations are inescapable property of any system that is capable of reproduction in the real world.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

What Is a Gene?

Table

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProGluGluLysSerAlaValThr
ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProValGluLysSerAlaValThr

Heredity is the passing of genes from one generation to the next. You inherit your parents ' genes. Heredity helps to make you the person you are today: short or tall, with black hair or blond, with brown eyes or blue. Can your genes determine whether you 'll be a straight - student or a great athlete? Heredity plays an important role, but your environment also influences your abilities and interests. People can have changes in genes that can cause many problems for them. Sometimes changes cause little differences, like hair color. Other changes in genes can cause health problems. Mutations in gene usually end up causing that particular gene copy to not do its job the way it normally should. Since we have two copies of every gene, typically there's still a normal working copy of gene. In these cases, usually nothing out of ordinary happens since the body can still do the jobs it needs to do. This is an example of autosomal recessive trait. For someone to have recessive disease or characteristic, person must have gene mutation in both copies of gene pair, causing the body to not have working copies of that particular gene. Genes can be either dominant or recessive. Dominant genes show their effect even if there is just one mutation in one copy of that gene pair; one mutation dominates the normal back - up copy of the gene, and the characteristic shows itself. People can be born with gene mutations, or they can happen over their lifetime. Mutations can occur when cells are aging or have been exposed to certain chemicals or radiation. Fortunately, cells usually recognize these types of mutations and repair them by themselves. Other times, however, they can cause illnesses, such as some types of cancer. If gene mutations exist in egg or sperm cells, children can inherit gene mutations from their parents. When mutation is in every cell of the body, body is not able to repair gene change.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

What Are Genetic Disorders?

Table

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProGluGluLysSerAlaValThr
ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACT
StartValHisLeuThrProValGluLysSerAlaValThr

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

8. Super Vision

As far as color vision go, humans have pretty keen sight relative to other animals. Having three types of cones present in our eyes gives us an evolutionary advantage as hunter - gatherers by better enabling us to spot fruits and berries than animals with only two types of cones. Color blindness is a condition caused by gene mutation that disables one of these cones. It is much more common in males, since genes responsible for detecting colors red and green are found only on the X chromosome. Because men only have one X copy, if mutations on the X chromosome occur, theyre more likely to exhibit altered traits than women who have two X chromosomes. But what if instead of disabling one of the cones, mutation increased the range of colors it was able to detect? If mutation occur in man it would likely only result in slightly shifted color spectrum. But in woman, if one of her X chromosomes had this mutation and the other one didnt, it would hypothetically result in her possessing the ability to see an increased range of colors undetectable by most people. According to a study published in Journal of Vision, roughly 12% of women have this sort of super Vision, although scientists have officially labelled condition tetrachromacy.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Sources

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

logo

Plex.page is an Online Knowledge, where all the summaries are written by a machine. We aim to collect all the knowledge the World Wide Web has to offer.

Partners:
Nvidia inception logo

© All rights reserved
2021 made by Algoritmi Vision Inc.

If you believe that any of the summaries on our website lead to misinformation, don't hesitate to contact us. We will immediately review it and remove the summaries if necessary.

If your domain is listed as one of the sources on any summary, you can consider participating in the "Online Knowledge" program, if you want to proceed, please follow these instructions to apply.
However, if you still want us to remove all links leading to your domain from Plex.page and never use your website as a source, please follow these instructions.