Advanced searches left 3/3
Search only database of 8 mil and more summaries

Smn1 And Smn2

Summarized by PlexPage
Last Updated: 02 July 2021

* If you want to update the article please login/register

General | Latest Info

Spinal muscular atrophy is caused by a mutation in survival motor neuron 1 gene. This gene is responsible for producing survival motor neuron protein, which maintains health and normal function of motor neurons. In individuals with Spinal muscular atrophy, both copies of SMN1 gene are mutate, leading to decreased production of SMN protein. Without a proper level of SMN protein, motor neurons in the spinal cord will be lose, preventing muscles from receiving proper signals from the brain. Spinal muscular atrophy affects everyone differently, and it is important to note that symptoms can vary greatly according to age of onset and disease severity. Individuals may experience progressive muscle weakness in muscles closest to the center of the body, such as shoulders, thighs, and pelvis. These muscles enable activities such as head control / movement, sitting up, crawling, and walking. Breathing and swallowing may also be affect. It is believed that Spinal muscular atrophy does not affect neurons responsible for cognition, which is a mental process through which we gain knowledge and understanding through thought, experience, and senses. According to one study, children and adolescents with Spinal muscular atrophy have normal intelligence, with IQs in the standard range. For school - age children, special accommodation may be needed to help maintain cognitive and intellectual engagement. It is believed that Spinal muscular atrophy does not affect neurons responsible for cognition, which is a mental process through which we gain knowledge and understanding through thought, experience, and senses. According to one study, children and adolescents with Spinal muscular atrophy have normal intelligence, with IQs in the standard range. For school - age children, special accommodation may be needed to help maintain cognitive and intellectual engagement. All individuals with Spinal muscular atrophy have at least one backup gene, known as SMN2. The SMN2 gene has a similar structure to SMN1, but only a small amount of SMN protein it produces is fully functional. This low level of SMN protein is not effective enough to sustain survival of motor neurons in CNS. The number of SMN2 genes may vary, and higher SMN2 copy number is associated with less - severe symptoms of Spinal muscular atrophy. Nevertheless, disease has a wide range of symptoms and it is difficult to predict severity based on the number of SMN2 copies alone. Thus, experts recommend that care decisions be made based on individuals ' functional ability and not on SMN2 copy number alone. Discovery of this backup gene provides a unique opportunity for development of potential therapies that may help SMN2 gene produce more SMN protein. The number of SMN2 genes may vary, and higher SMN2 copy number is associated with less - severe symptoms of Spinal muscular atrophy. Nevertheless, disease has a wide range of symptoms and it is difficult to predict severity based on the number of SMN2 copies alone. Thus, experts recommend that care decisions be made based on individuals ' functional ability and not on SMN2 copy number alone.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Spinal muscular atrophy

Why are SMN1 and SMN2 copy numbers important and why are they challenging to analyze? Smn1 and SMN2 are located close to each other AT complex SMN region on chromosome 5q12. 2 - q13. 3 where repetitive sequences, pseudogenes, transposable elements, deletions and inverted duplications are not unusual. Smn1 Gene shares more than 99% nucleotide identity with SMN2 Gene; both genes encode 294 - amino acid RNA - binding protein, SMN, that is required for efficient assembly of small nuclear ribonucleoprotein complexes. These two genes, both containing nine exons, can be distinguished only by eight nucleotides, making molecular differentiation of these genes extremely difficult. This case report describes, how diagnosis of spinal muscular atrophy was confirmed for patient, what testing was choose, and why the SMN1 / SMN2 region is so difficult to sequence.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

SMN1, SMN2

Several studies have now shown that SMN2 copy number modifies severity of disease. 25 31 45 - 47 SMN2 is retained in all patients and generates low levels of SMN protein but does not fully compensate for mutated SMN1. The Copy number varies from zero to three copies in normal population, with about 10 - 15% of normal individuals having no SMN2. Sma patients with single SMN2 copy are rare but are highly predictive of severe type - I phenotype with poor prognosis. The majority of patients with type - I form have one or two copies of SMN2; most patients with type II have three SMN2 copies; and most patients with type III have three or four SMN2 copies. Three unaffected family members of SMA patients, with confirmed SMN1 homozygous deletions, were shown to have five copies of SMN2. 48 these cases not only support the role of SMN2 modifying phenotype, but they also demonstrate that expression levels consistent with five copies of SMN2 genes may be enough to compensate for the absence of SMN1 gene. The relationship between SMN2 copy number and disease severity has also been recapitulated SMA mouse model. 49 SMN2 copy number analysis may be of particular value within the setting of clinical trials and newborn screening in stratifying patients who are more likely to respond to therapeutic strategies aimed at upregulating levels of expression of full - length SMN protein from SMN2 gene. Within clinical or prenatal diagnostic settings, however, results from SMN2 copy number analysis, if available, must be interpreted with caution. Although this inverse correlation between SMN2 copy number and disease phenotype has been well establish, there are exceptions to association. Three copies of SMN2 are occasionally found in type - I patients and two copies in some milder type - II patients. Furthermore, SMN2 sequence variants and other genes may also influence SMA phenotype. Single - base substitution in SMN2, C. 859g > C, was identified in exon 7 in patients ' DNA, and it was shown that substitution creates new exonic splicing enhancer element. 50 new ESE increases the amount of exon 7 inclusion and full - length transcripts generated from SMN2, thus resulting in increased level of SMN protein and less severe phenotype. Therefore, SMA phenotype may not only be modified by the number of SMN2 genes, but SMN2 sequence variations can also affect disease severity. It also remains unclear whether SMN2 copy numbers always represent fully intact copies of SMN2 gene in these patients. Due to the nature of SMN loci, deletion breakpoints have been difficult to identify. If SMN2 genes are truncate, they may not produce full - length transcripts and therefore be nonfunctional. In addition to SMN2, other modifying factors influence phenotypic variability of SMA. There are very rare family reports in which markedly different degrees of disease severity are present in affected siblings with the same SMN2 copy number.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Results

Results obtained according to quantitative analyses show that ranges of 2 CT values do not overlap with those corresponding to each category of gene copy numbers. Table 1 shows the range of values of 2 CT of SMN1 and SMN2 genes in non - relate control individuals. One out of those 49 analyzed subjects was considered to be Carrier for SMN1 deletion, with a value of 2 CT = 0. 35; giving an estimated allelic frequency of 0. 1 in Venezuelan sample. Thirty - seven individuals were unequivocally classified as carriers of two copies of SMN1 gene, Two individuals were classified as carriers of 3 copies of SMN1, two as carriers of 4 - 5 copies, and one with a value of 2 CT eventually corresponding to dose of 6 copies of that gene. Results for the SMN2 gene show that 27 subjects carried single copy of the gene, 7 individuals possess 2 copies, and 5 had 3 copies. Sample numbers considered high had no copies of SMN2; in them, values of 2 CT were equal or very close to 0. 00, indicating homozygous absence of gene. In the control sample, there were 6 borderline cases in which classification into one or two gene copy category could not be priori unequivocally establish. In them, average values of 2 CT do not overlap with that of obligatory Carrier parents Figure of affected subjects. Nonetheless, upper limits in ranges were very close, so it was necessary to establish the cutoff value of each category by calculating it through use of discriminant equation. Threshold value L = 0. 66 was estimate, which permitted to classify those individuals within the most probable gene copy number category. That is, with values below 0. 66, it was considered likelier to belong to the Carrier range, and with values above it, it was likelier to belong to the range of 2 copies. Therefore, according to this final classification, estimated frequency of carriers of 2 SMN1 copies in the Venezuelan control sample was 87. 8%. Use of additional techniques such as multiplex ligation - dependent probe amplification could validate this classification. All fourteen index cases without typical clinical findings of SMA had two copies of SMN1 gene. In them, etiology of hypotonia was diverse but not attributable to lower Motor Neuron impairment; thus, further differential diagnoses were assess. Three out of fifteen families in whom molecular confirmation of SMA was established were consultand parents whose first child had died in the first months of life, with severe hypotonia and typical signs of SMA, but in whom DNA diagnosis of disease had not been previously make. All of the results carry a single copy of SMN1. In 11 families, SMA was confirmed in index case by homozygous deletion of exon 7 of SMN1. In total, 16 individuals with this genotype were detect. Table 3 shows clinical features of those patients.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Background

Spinal muscular atrophy is one of the most common autosomal recessive diseases. Sma is characterized by degeneration of alpha motor neurons in the spinal cord and medulla oblongata, causing symmetrical proximal muscular atrophy. The incidence of SMA is approximately 1 / 6000 to 1 / 10 000 live births, and heterozygous healthy carriers show very high frequency in the general population. In Middle East countries, carrier frequencies are higher. In Morocco, it is 1 / 25 individuals, as well as in Iran, and Saudi Arabia, carrier frequency is 1 in 20. Sma can be classified into five clinical grades based on age of onset and severity of disease. Type 0 SMA patients present with very severe hypotonia and respiratory distress at birth. These SMA infants do not survive beyond 6 months. Type I SMA patients have an age of onset before 6 months at which hypotonia can be observed, followed by progressive weakness which is worse proximally than distally and is initially more obvious in legs, making it difficult for them to sit up. They do not have the ability to sit without support and their life expectancy is less than 2 years; because muscle weakness affects chest wall and diaphragm causing breathing difficulty and respiratory failure. Type II SMA patients have age of onset before 18 months. These patients ultimately attain the ability to sit independently when place. However, most of these patients can hardly stand without support. Their life expectancy is until early adulthood. Type III SMA patients have an age of onset > 18 months. These patients are able to walk independently and their legs are weaker than their arms. Type III patients usually have normal lifespan. Type IV SMA patients have age of onset after the age of 10 years. They exhibit slowly progressive limb weakness and are associated with normal life expectancy. All five clinical subtypes were mapped to chromosome 5q13. 2 region with large inverted duplication with several repeat genes. In 1995, survival motor neuron 1 was identified as an SMA disease - determining gene. Smn gene exists in 2 highly homologous copies that have been mapped to chromosome region 5q13. Approximately 94% of clinically typical SMA patients have homozygous deletion of exon 7 of telemetric copy of gene, and most carriers have only one copy of SMN1 exon 7, as determined by SMN gene dosage analysis. The centeromeric copy of SMN gene is almost identical to SMN1. The only critical difference is the transition in exon 7, which is translationally silent; however, it affects splicing pattern. Both SMN genes code for full - length RNA with nine exons, but SMN2 mainly produces transcript without exon 7 that encodes truncate, non - functioning SMN protein. As a result, SMN7 is a major product of SMN2 and the number of copies of SMN2 is linked to the severity of disease. Approximately 20% of mRNA generated from SMN2 locus encodes SMN by virtue of alternative splicing; thus, larger number of SMN2 copies correlate with milder form of disease.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Methods

We call number of chromosomes carrying SMN1 and SMN2 bases by combining total SMN CN with read counts supporting each of gene - specific bases. At each SMN1 / 2 differentiating base, based on call copy number of intact SMN, caller iterates through all possible combinations of SMN1 and SMN2 copy numbers and derives a combination that produces the highest posterior probability for observed number of SMN1 and SMN2 supporting reads. Smn1 CNs calls on a single basis are then combined to make aggregate SMN1 CN calls based on consensus rule. In addition to calling CN of bases that are specific to either SMN1 or SMN2, this method can be applied to variant positions to identify copy number of bases known to be specific to one of two genes, eg, C. * 3 + 80T > G as described in the results.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Causes/Inheritance

Spinal Muscular Atrophy is a group of inherited disorders that cause progressive muscle degeneration and weakness. Spinal Muscular Atrophy is the second leading cause of neuromuscular disease. It is usually inherited as an autosomal recessive trait. There are several types of SMA called subtypes. Each of the subtypes is based on the severity of disorder and age at which symptoms begin. There are three types of SMA that affect children before the age of 1 year. There are two types of SMA, type IV and Finkel type, that occur in adulthood, usually after age 30. Symptoms of adult - onset Spinal Muscular Atrophy are usually mild to moderate and include muscle weakness, tremor and twitching. The prognosis for individuals with SMA varies depending on the type of SMA and degree of respiratory function. A patient's condition tends to deteriorate over time, depending on the severity of symptoms. Spinal Muscular Atrophy affects 1 in 6 000 to 1 in 10 000 people. Three types of SMA affect children before age one year. Type 0 is the most severe form of Spinal Muscular Atrophy and begins before birth. Usually, first symptom of type 0 is reduced movement of the fetus that is first seen between 30 and 36 weeks of pregnancy. After birth, these newborns have little movement and have difficulties with swallowing and breathing. Type I Spinal Muscular Atrophy is another severe form of SMA. Symptoms of type 1 may be present at birth or within the first few months of life. These infants usually have difficulty breathing and swallowing, and they are unable to sit without support. Children with type II SMA usually develop muscle weakness between the ages of 6 and 12 months. They cannot stand or walk without help. Type III SMA is a milder form of SMA than Types 0, I or II. Symptoms appear between early childhood and early adulthood. Individuals with type III SMA are able to stand and walk without help. They usually lose their ability to stand and walk later in life. There are two other types of Spinal Muscular Atrophy, type IV and Finkel type that occur in adulthood, usually after age 30. Symptoms of adult - onset SMA are usually mild to moderate and include muscle weakness, tremor and twitching. To make diagnosis of SMA, symptoms need to be present. When symptoms are present, diagnosis can be made by genetic testing. Gene alterations in SMN1 and VAPB genes cause SMA. Having extra copies of SMN2 gene can modify the course of SMA. Genetic testing on blood or tissue samples is done to identify whether there is at least one copy of the SMN1 gene by looking for its special makeup. Mutations in SMN1 gene cause type 0, I, II, III, and IV. Some people who have SMA type II, III, or IV have three or more copies of the SMN2 gene. Having these extra copies can modify the course of SMA. More copies of SMN2 gene person has, less severe or her symptoms.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Introduction

Spinal muscular atrophy is an autosomal recessive disorder caused by mutations in SMN1 gene. 1 SMN2, SMN1 homologue, typically differs from SMN1 by five nucleotides. 2 Only one of these nucleotide changes is in coding sequence, and it is translationally silent. 2 Approximately 94% of clinically typical SMA patients lack both copies of SMN1 exon 7 3 and most carriers have only one copy of SMN1 exon 7, as determined by SMN gene dosage analysis. 4 5 in addition to large deletions that include the entire SMN1 gene, loss of SMN1 exon 7 can occur by gene conversion from SMN1 to SMN2. 6 SMA type III patients have, on average, more SMN2 copies than SMA type II or type I patients, 7 8 9 and hence more copies of SMN2 derived by conversion from SMN1. Copy number of SMN2 correlates with longer survival and inversely with disease severity. 8 9 Although gene conversion from SMN1 to SMN2 has been demonstrate, gene conversion from SMN2 to SMN1 has not. We show herein that increased SMN1 copy number is associated with decreased SMN2 copy number in the general population, which provides evidence that gene conversion from SMN2 to SMN1 occurs, and that SMN1 convert from SMN2 is present in the general population.


MATERIALS AND METHODS

To determine if each sample contains SMN1 and / or SMN2, exon 7 of SMN was amplified by PCR, using SMN - SEQ7F and SMN - SEQ7R as primers. Pcr conditions were as follow: 5 min 96C followed by 40 cycles of 30 sec 96C, 30 sec 56C and 1 min 72C followed by the final extension step for 7 min at 72C. The PCR product was purified using Wizard SV Gel and PCR Cleanup System according to manufacturers directions. Purify PCR product was sequence with ABI 3130xl Genetic Analyzer automate sequencer, using BigDye Terminator v3. 1 Cycle Sequencing kit.


DISCUSSION

We established a new array dPCR SMN1 and SMN2 copy number assay that accurately measures copy numbers in SMA as well as in non - SMA DNA samples isolated from whole blood cells and cell lines derived from fibroblasts and lymphoblasts. Dpcr - derive SMN1 and SMN2 copy numbers match those found in reference standards used by diagnostic laboratory and in a limited number of cases using microdroplet dPCR. Smn2 copy numbers in SMA DNA samples were concordant with those results measured by TaqMan qPCR at low SMN2 copy numbers but concordance was not as strong at higher SMN2 copy numbers. The majority of dPCR / TaqMan qPCR mismatches occur at higher SMN2 copy numbers where TaqMan qPCR assay cannot easily distinguish unit differences. Array dPCR detects unit differences in SMN2 copy number over a wide range of SMN2 copy numbers similar to droplet dPCR. Because of this wide range of detection, dPCR can be very useful in accurately quantifying SMN2 copy numbers in patients with milder forms of SMA, that is, type III SMA, who generally have higher SMN2 copy numbers. Reliability of array dPCR assays was determined by comparing coefficients of variation for all samples with the same copy number. Our array dPCR results had 1. 6 - 3. 7% CV for SMN1 and 2. 1 - 3. 7% CV for SMN2. In contrast, TaqMan qPCR assay show 5. 2 - 9. 7% CV for SMN1 and 0. 8 - 7. 6% CV for SMN2. Greater reliability of array dPCR assay when compared against TaqMan qPCR assays is the result of random distribution of template DNA molecules within 20 000 partitions in microfluidic dPCR array. Using array dPCR, we have confirmed very strong inverse correlation between SMN2 copy number and disease severity in our SMA patient samples. Numerous previous studies also document a similar relationship between SMN2 copy number and SMA disease severity. Smn2 copy number is associated with many measures of SMA phenotype severity including gross motor function, force vital capacity, muscle mass, and denervation. Many current and future clinical trials for SMA will use these outcomes measures along with changes in SMN expression to gauge efficacy. Because SMN2 copy number is the defining criteria of eligibility for many SMA clinical trials, accurate and reliable measurements will continue to be essential to clinical research. In some cases, within our pool of SMA samples, there were SMA patients with low SMN2 copy numbers exhibiting milder phenotype. A rare variant in SMN2, SMN2 C. 859g > C, may explain this finding as it results in partial rescue of truncated, exon 7 exclude, transcripts that characterize most of the mRNA generated from SMN2. Array dPCR will aid in identification of cases having mismatches from expected genotype - phenotype relationship. Identifying such mismatches could lead to identification of potential complementing mutations in SMN2 like SMN2 C. 859g > C. Array dPCR can be easily used to measure SMN1 and SMN2 copy numbers accurately in DNA samples obtained from SMA patients and healthy, non - SMA controls.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Discussion

It has been proposed that the higher level of exon 7 inclusion in SMN1 transcripts compared with SMN2 transcripts is due to more efficient recruitment of U2AF to SMN1 intron 6 3 splice site. To test this hypothesis, we first confirm that recognition of SMN1 and SMN2 intron 6 by U2 snRNP requires U2AF, as is the case for most, but not all 3 splice sites. Second, we tested whether U2AF's intrinsic binding affinity is higher for SMN1 than for SMN2 transcripts. Radioactively labelled RNAs comprising 3 68 nucleotides of SMN intron 6, SMN1, or SMN2 exon 7 and 25 nt of intron 7 were incubated with purified recombinant U2AF 65, or partially purified U2AF heterodimer from HeLa cells, in presence of excess of unrelated RNA. Rna - protein complexes were then resolved by electrophoresis in native gels. To avoid nonspecific RNA - protein interactions mediated by positively charged RS domain express in Escherichia coli, U2AF 65 derivative lacking RS domain region was used in these experiments. As expected from the report binding specificity of U2AF for polypyrimidine tracts, U2AF 65 and partially purifed U2AF heterodimer display comparable apparent binding affinities for SMN1 and SMN2 RNAs used which differ only at position 6 of exon 7. Next, possibility that additional factors, differentially recruited to SMN1 and SMN2 RNAs, influence U2AF binding was addrest using ultraviolet light - induced crosslinking / immunoprecipitation. 32 P - uridine label RNAs described above were incubated with HeLa nuclear extract, irradiated with short wavelength UV - light, and after RNAse digestion, U2AF 65 was immunoprecipitated using a specific MC3 monoclonal antibody. Radioactively labelled U2AF 65 was identified by electrophoresis on SDS gels and PhosphorImager analysis. First, specificity of U2AF 65 crosslinking for polypyrimidine tract of intron 6 was assessed using mutant versions of RNAs in which uridine residues in region upstream of exon 7 were replaced by cytidines. Results of Figure 2C indicate that U2AF 65 crosslinking to both SMN1 and SMN2 wild - type transcripts was readily detectable, while crosslinking to Py - mut RNAs was not, indicating that crosslinking signal reflects specific interaction of U2AF 65 with Py - tract region of SMN1 and SMN2 intron 6. To verify that the crosslinking / immunoprecipitation assay was quantitative, we performed assay using increasing concentrations of nuclear extract. Results of Figure 2D show that increasing concentrations of nuclear extract result in increased levels of U2AF 65 crosslinking to SMN1 and SMN2 RNAs, indicative of the quantitative nature of assay. Importantly, extent of U2AF 65 crosslinking to SMN1 was consistenly higher than to SMN2 RNA. Because the overall pattern of protein crosslinking in nuclear extract is comparable for both RNAs, difference observed in U2AF 65 crosslinking is specific for interaction between this protein and SMN1 and SMN2 transcripts. Figure 2E quantifies results of several independent experiments confirming approximately twofold higher levels of crosslinking of U2AF 65 to SMN1 than to SMN2 intron 6 3 splice site.


MATERIALS AND METHODS

Pcismnx - wt or pCISMNx - c6t were used to transcribe SMN1 and SMN2 RNAs. Py - mut constructs were obtained by replacing thymidine residues contained in polypyrimidine tract by cytidines via PCR - base site - directed mutagenesis of pCI plasmids as described by Hemsley et al. Using 5 - phosphorylated oligonucleotides. Templates used to generate transcripts containing 3 68 nt of intron 6, complete sequence of exon 7 and 26 nt of intron 7 were generated by PCR using primers SMNCXLFor 5 - CGTAATACGACTCACTATAGGGCTATCTATATATAGCTATC - 3 and SMNCXLBack 5 - CACTTTCATAATGCTGGCAG - 3. Rnas were synthesize from 400 ng of PCR templates in 25 L transcription reactions containing 40 mM Tris - HCl, 10 mM NaCl, 6 mM MgCl 2 2 mM spermidine, 0. 8 mM DTT, 0. 4mm ATP, CTP, and GTP, 0. 08 mM UTP, 36 U of T7 RNA polymerase and 50 Ci UTP. Full - length substrates were transcribed in the presence of 1. 9 mM CAP - analog pppG New England Biolabs and GTP was at 0. 04 mM final concentration. Reactions were incubated for 2 h at 37C and transcription products were gel - purify.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Target Information

Success OF target - base screening strongly relies on adequate selection OF biological target. Therefore, we first seek to validate the suitability of TSL2 as a target for small - molecule screening. To this end, HeLa cells were transiently transfected WITH battery OF SMN1 and SMN2 minigenes containing exons 6 - TO - 8 and bearing different structural mutations in TSL2. These include mismatch mutations, mutation in loop and base - pairing strengthening mutation. All mutations were located in 5 half OF TSL2 hairpin, in order TO avoid interference WITH recognition OF 5 ss OF E7 AT Sequence level. Smn2 minigenes carrying mismatch mutations in TSL2 stem, as well as loop mutation, show an increase in SMN2 E7 inclusion levels, which range FROM 16% to 62%. Conversely, strengthening OF base pairing in TSL2 promote E7 skipping in SMN1. These results are in agreement with the previous report using different cell line 16. To confirm that the effect of these mutations on SMN2 splicing was linked TO conformational changes in TSL2, series OF low - resolution structural Methods were used on synthetic TSL2 RNAs, both in THEIR mutated and non - mutated versions. First, TSL2 base stacking was indirectly measured by labelling TSL2 RNAs with fluorescent structural probe 2 - aminopurine 22, emission OF which is quench by RNA base contacts. 2ap fluorescence measurements show that all mutations induce RNA - stacking changes that significantly correlate WITH E7 inclusion, WITH exception OF 4G mutation. Visualisation of hairpin formation using native PAGE confirms these findings. 4g mutation trigger strongest conformational changes in TSL2. However, SMN2 splicing was only mildly affect, suggesting that a certain level OF TSL2 structure is required FOR exon inclusion, or that protein - binding sequence may have been affected by this mutation. Circular dichroism spectroscopy was used TO further confirm these observations using non - label TSL2 RNAs. In these experiments, all TSL2 RNAs show positive CD peak AT ~265 nm typical OF RNA and negative peak AT ~210 nm typical OF - Form. At low temperature, all mutations cause either reduction in CD signal OF TSL2 or significant wavelength shift in positive peak, FROM 265 TO 269 nm, indicative OF changes in base stacking that were consistent WITH Our 2AP and PAGE Results. At denaturing temperature, all differences in CD spectra disappear, demonstrating that changes triggered by these mutations represent conformational features rather than sequence effects. In summary, these results demonstrate that triggering conformational changes in TSL2 can increase SMN2 E7 splicing values to nearly SMN1 levels, and confirm the potential OF TSL2 as a target for screening OF RNA structure - modifying small molecules able TO induce equivalent changes. Screening efforts TO find RNA - binding compounds typically yield low hit rates. However, hit rates are reported TO increase FROM ~1% TO ~19% when using small molecules WITH chemical scaffolds bias FOR RNA recognition; including indole, 2 - phenyl indole, 2 - phenyl benzimidazole and alkyl pyridinium 23.


Introduction

Spinal muscular atrophy, which involves motor neuron loss and progressive paralysis, is one of the most common autosomal recessive disorders with a carrier frequency of 1 in 50. Three types have been described on the basis of onset and severity. Type I is the most severe form. 1 gene responsible for SMA maps to region of inverted duplication on 5q11. 2 - q13. 3 and is called survival of motor neuron.S 2 Homozygous absence of telomeric copy, SMN1, is the main cause of SMA. Centromeric copy, SMN2 differs in regulation of exon splicing, resulting in exon skipping. 3 short isoform of SMN protein, which is less stable than full - length SMN protein, cannot compensate for loss of SMN1 gene in SMA patients. 3 severity of disease is correlated with the amount of full - length SMN protein, which depends on the number of SMN2 gene copies. The 4 5 SMN protein was first identified as part of a multiprotein complex that appears to play a critical role in spliceosomal snRNP assembly in cytoplasm and is required for pre - mRNA splicing in the nucleus. 6 7 8 However, it is unclear why deficiency in SMN, ubiquitously express gene, mostly affect neurons. Smn protein levels are high in normal spinal cord and much lower in the spinal cord of SMA patients. The 4 9 10 level of SMN expression depends on synaptic activation. 11 Furthermore, SMN appears to accumulate in axonal growth cones and dendrites. 12 13 function of SMN in motor axon development has been well conserved during evolution, as shown in zebrafish 14 and in mice. 15 Thus, there seem to be neuron - specific regulator elements in SMN promoters. Previous studies of 1. 9 kb region upstream from transcriptional start site of SMN1 and SMN2 find no difference in activity between the two promoters. 16 17 We isolate genomic DNA from patients with deletions in SMN1 or SMN2, and sequence 4. 6 kb of 5 upstream region of SMN1 and SMN2 genes; sequences obtained were identical. We investigate early regulation of SMN expression by transiently transfecting mouse embryonic spinal cord and fibroblast primary cultures with three constructs containing 1. 8 3. 2 and 4. 6 kb, respectively, of SMN promoter driving - galactosidase gene expression. 4. 6 kb construct gives levels of expression five times higher in neurons than in fibroblasts. This differential expression results from effects of the combination of general enhancer and non - neuronal cell silencer. Our findings suggest that SMN protein may fulfil specific neuronal functions during development.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Measuring SMN1 and SMN2 CNVs

Amyotrophic lateral sclerosis is mostly adult - onset motor neuron disease characterized by progressive loss of motor function leading to paralysis and respiratory failure. Unlike SMA, ALS is caused by degeneration of LMNs as well as upper motor neurons. Als is usually fatal within 3 - 5 years after disease onset but there is considerable variability with respect to duration as well as phenotypic presentation. Most cases of ALS are sporadic in nature since there is no apparent family history. Approximately 10% of ALS is considered familial since either a causative gene has been identified or there is a strong family history. With recent advents in whole exome and whole genome sequencing, genetic bases of almost 70% of familial ALS and 10% of sporadic ALS have been identify. There are many case studies reporting co - occurrence of SMA and ALS within family which suggest that SMN1 deficiency may lead to ALS in addition to SMA. Smn1 deletions, however, have not been observed in either familial or sporadic ALS patients. Furthermore, no intragenic point mutations in SMN1 have been reported in the ALS population. Intrafamilial coexistence of SMA and ALS, therefore, occurs by chance. Even though loss of SMN1 is not associated with ALS, CNVs in SMN genes may modulate clinical severity of ALS in addition to SMA. Multiple studies suggest that deletion of SMN2 leads to increased risk of sporadic forms of amyotrophic lateral sclerosis. Additionally, atypical SMN1 copy numberin other words, any number other than twocan affects risk of ALS. Other studies, however, have shown no association between deletion of either SMN1 or SMN2 in ALS. Discrepant results from these studies may be due, in part, to different assays used to assess SMN1 and SMN2 CNVs as some reports using quantitative PCR while others use MLPA or RFLP. Smn and some ALS - associate proteins are involved in common biochemical pathways. Both familial and sporadic ALS have been linked to mutations in fuse in sarcoma as well as in TAR DNA binding protein - 43 kDa. Both FUS and TDP - 43 colocalize with SMN in subnuclear gems and ALS - associate mutations in FUS and TDP - 43 reduce gem localization of SMN. Gem localization of SMN, however, is not altered in other forms of sporadic ALS. These mutant proteins also disrupt SMN - mediate assembly of splicing machinery by disrupting interaction between SMN and U1 - snRNPs. Additionally, ALS - associate FUS mutations disrupt localization of SMN to axons. Smn function, therefore, may be disrupted in certain forms of ALS. Ectopic overexpression of SMN protects NSC34 motor neuron - like cells from cell death induced by ALS - associated mutant superoxide dismutase 1. The Sod1 transgenic mouse model for ALS that also harbor knockout of 1 mSmn allele exhibits more severe ALS phenotype than SOD1 ALS mice. Furthermore, ectopic overexpression of SMN in neurons and glia improves motor function and delays motor neuron loss in SOD1 ALS mice.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Conclusions

We implement PCR - RFLP, multiplex PCR, and real - time PCR to analyze the correlation between CNVs of SMN1, NAIP, and SMN2 genes and SMA phenotype in Egyptian patients. Although we use three different molecular techniques to generate genotype of SMA patients, studies show preference for combination of modifier genes as prognostic genetic pattern for phenotype determination rather than using SMN2 CNVs only. Genetic patterns including SMN1, SMN2, and NAIP genes can help more in prognosis of more severe SMA types rather than less severe types. Moreover, determination of CNVs of exon 7 of SMN2 is of great importance in placement of effectiveness of new therapy, as it depends on having at least one copy of exon 7 of SMN2 gene.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

Sources

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions.

* Please keep in mind that all text is machine-generated, we do not bear any responsibility, and you should always get advice from professionals before taking any actions

logo

Plex.page is an Online Knowledge, where all the summaries are written by a machine. We aim to collect all the knowledge the World Wide Web has to offer.

Partners:
Nvidia inception logo

© All rights reserved
2021 made by Algoritmi Vision Inc.

If you believe that any of the summaries on our website lead to misinformation, don't hesitate to contact us. We will immediately review it and remove the summaries if necessary.

If your domain is listed as one of the sources on any summary, you can consider participating in the "Online Knowledge" program, if you want to proceed, please follow these instructions to apply.
However, if you still want us to remove all links leading to your domain from Plex.page and never use your website as a source, please follow these instructions.